               SEQUENCE LISTING

<110> spRNA GmbH

<120> Immunostimulating-toxic RNA in alkalkine earth metal formulation
<130> S 0405 WO

<160> 7

<170> BiSSAP 1.0

<210> 1
<211> 18
<212> RNA
<213> artificial sequences

<220> 
<221> source
<222> 1..18
<223> /mol_type="RNA"
      /note="Immunostimulating and tumor cytotoxic RNA"
      /organism="artificial sequences"

<220> 
<221> mod_base=OTHER
<222> 2
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 4..5
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 7..8
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 10
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 12
<223> /note="5-fluoro-uridine"

<400> 1
auauucuuguaugggggg                                                    18


<210> 2
<211> 18
<212> RNA
<213> artificial sequences

<220> 
<221> source
<222> 1..18
<223> /mol_type="RNA"
      /note="Immunostimulating and tumor cytotoxic RNA"
      /organism="artificial sequences"

<220> 
<221> mod_base=OTHER
<222> 8..9
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 11..12
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 14
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 16
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 18
<223> /note="5-fluoro-uridine"

<400> 2
ggggggauucuuguauau                                                    18


<210> 3
<211> 21
<212> RNA
<213> artificial sequences

<220> 
<221> source
<222> 1..21
<223> /mol_type="RNA"
      /note="Immunostimulating and tumor cytotoxic RNA"
      /organism="artificial sequences"

<220> 
<221> mod_base=OTHER
<222> 3
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 5..6
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 8
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 10..11
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 13
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 15
<223> /note="5-fluoro-uridine"

<400> 3
aguguuaucuuguaugggggg                                                 21


<210> 4
<211> 24
<212> RNA
<213> artificial sequences

<220> 
<221> source
<222> 1..24
<223> /mol_type="RNA"
      /note="Immunostimulating and tumor cytotoxic RNA"
      /organism="artificial sequences"

<220> 
<221> mod_base=OTHER
<222> 2
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 4..5
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 7..8
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 10
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 12
<223> /note="5-fluoro-uridine"

<400> 4
auauucuuguaugggggggggggg                                              24


<210> 5
<211> 24
<212> RNA
<213> artificial sequences

<220> 
<221> source
<222> 1..24
<223> /mol_type="RNA"
      /note="Immunostimulating and tumor cytotoxic RNA"
      /organism="artificial sequences"

<220> 
<221> mod_base=OTHER
<222> 8
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 10..11
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 13..14
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 16
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 18
<223> /note="5-fluoro-uridine"

<400> 5
ggggggauauucuuguaugggggg                                              24


<210> 6
<211> 18
<212> RNA
<213> artificial sequences

<220> 
<221> source
<222> 1..18
<223> /mol_type="RNA"
      /note="Immunostimulating and tumor cytotoxic RNA"
      /organism="artificial sequences"

<220> 
<221> mod_base=OTHER
<222> 2
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 4..8
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 10
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 12
<223> /note="5-fluoro-uridine"

<400> 6
auauuuuuguaugggggg                                                    18


<210> 7
<211> 24
<212> RNA
<213> artificial sequences

<220> 
<221> source
<222> 1..24
<223> /mol_type="RNA"
      /note="Immunostimulating and tumor cytotoxic RNA"
      /organism="artificial sequences"

<220> 
<221> mod_base=OTHER
<222> 8
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 10..11
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 13..14
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 16
<223> /note="5-fluoro-uridine"

<220> 
<221> mod_base=OTHER
<222> 18
<223> /note="5-fluoro-uridine"

<400> 7
ggggggauauucuuguaugggggg                                              24
