

SEQUENCE LISTING


<110> GENOMICA S.A.U.

<120> Method for detection of BRAF and PIK3CA mutations

<130> PC927036WO

<160> 30

<170> PatentIn version 3.3


<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> 3'sequence of ARMS primer for amplification of BRAF mutation
V600E, the sequence being target-specific

<400> 1
ggtgattttg gtctagcttc aga						23

<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> 3'sequence of ARMS primer for amplification of BRAF mutation
V600K, the sequence being target-specific

<400> 2
ggtgattttg gtctagctac taa						23

<210> 3
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> ARMS primer for amplification of BRAF mutation V600E

<400> 3
gattagcgca gtgcactacg gtgattttgg tctagcttca ga				42

<210> 4
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> ARMS primer for amplification of BRAF mutation V600K

<400> 4
agatcgttat caatcgcatg gtgattttgg tctagctact aa				42

<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Amplification primer to be used in combination with any of
ARMS primers comprising SEQ ID N 1 and 2, or
ARMS primers consisting of SEQ ID N 3 and 4.

<400> 5
ggccaaaaat ttaatcagtg ga						22

<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> 5 sequence of ARMS primer for amplification of BRAF mutation
V600E, the sequence being non-target-specific.
This sequence is also present in the detection probe of
BRAF mutation V600E.

<400> 6
gattagcgca gtgcactac							19

<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> 5 sequence of ARMS primer for amplification of BRAF mutation
V600K, the sequence being non-target-specific.
This sequence is also present in the detection probe of
BRAF mutation V600K.

<400> 7
agatcgttat caatcgcat							19

<210> 8
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
BRAF mutation V600E

<400> 8
cgggttaccc gggagtctcg attagcgcag tgcactac				38

<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
BRAF mutation V600K

<400> 9
agatcgttat caatcgcatg gtgat						25

<210> 10
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
BRAF mutation V600K

<400> 10
cgggttaccc gggagatcgt tatcaatcgc at					32									
<210> 11
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
BRAF mutation V600K

<400> 11
cgggttaccc gggagtctca gatcgttatc aatcgcat				38

<210> 12
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> 3'sequence of ARMS primer for amplification of PIK3CA mutation
E542K, the sequence being target-specific

<400> 12
aagcaatttc tacacgagat cctctgtcta					30

<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> 3'sequence of ARMS primer for amplification of PIK3CA mutation
E545D, the sequence being target-specific

<400> 13
cctctctctg aaatcagtga t							21

<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> 3'sequence of ARMS primer for amplification of PIK3CA mutation
E545K, the sequence being target-specific

<400> 14
gatcctctct ctgaaatcag ta						22

<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> 3'sequence of ARMS primer for amplification of PIK3CA mutation
H1047R, the sequence being target-specific

<400> 15
gaaacaaatg aatgatgctc gt						22

<210> 16
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> ARMS primer for amplification of PIK3CA mutation E542K

<400> 16
agaccttagc atagcttaag caatttctac acgagatcct ctgtcta			47

<210> 17
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> ARMS primer for amplification of PIK3CA mutation E545D

<400> 17
actatagccg agtacggccc tctctctgaa atcagtgat				39

<210> 18
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> ARMS primer for amplification of PIK3CA mutation E545K

<400> 18
taactggcta tccggaggat cctctctctg aaatcagta				39

<210> 19
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> ARMS primer for amplification of PIK3CA mutation H1047R

<400> 19
cgatatgata tgctagttga aacaaatgaa tgatgctcgt				40

<210> 20
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Amplification primer to be used in combination with any of
ARMS primers comprising SEQ ID N 12, 13 and 14, or ARMS primers
consisting of SEQ ID N 16, 17 and 18.

<400> 20
acatgctgag atcagccaaa t							21

<210> 21
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Amplification primer to be used in combination with any of
ARMS primers comprising SEQ ID N 15, or ARMS primer consisting of SEQ ID N 19.

<400> 21
tggaatccag agtgagcttt c							21

<210> 22
<211> 17 
<212> DNA
<213> Artificial Sequence
<220>
<223> 5 sequence of ARMS primer for amplification of PIK3CA mutation E542K
the sequence being non-target-specific.
This sequence is also present in the detection probe of PIK3CA mutation E542K

<400> 22
agaccttagc atagctt							17

<210> 23
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> 5 sequence of ARMS primer for amplification of PIK3CA mutation E545D
the sequence being non-target-specific.
This sequence is also present in the detection probe of PIK3CA mutation E545D

<400> 23
actatagccg agtacggc							18

<210> 24
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> 5 sequence of ARMS primer for amplification of PIK3CA mutation E545K
the sequence being non-target-specific.
This sequence is also present in the detection probe of PIK3CA mutation E545K

<400> 24
taactggcta tccggag							17

<210> 25
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> 5 sequence of ARMS primer for amplification of PIK3CA mutation H1047R,
the sequence being non-target-specific.
This sequence is also present in the detection probe of PIK3CA mutation H1047R.

<400> 25
cgatatgata tgctagtt							18

<210> 26
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
PIK3CA mutation E542K

<400> 26
cgggttaccc gggagtctca gaccttagca tagctt					36

<210> 27
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
PIK3CA mutation E545D

<400> 27
cgggttaccc gggactatag ccgagtacgg c					31

<210> 28
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
PIK3CA mutation E545K

<400> 28
cgggttaccc gggagtctct aactggctat ccggag					36

<210> 29
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
PIK3CA mutation H1047R

<400> 29
cgatatgata tgctagtt							18

<210> 30
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for detection of ARMS amplification product of 
PIK3CA mutation H1047R

<400> 30

cgggttacccgggcgatatgatatgctagt						31



