<110> F. Hoffmann-La Roche AG 
  
<120> COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF IL-18 GENES 

<130> 26499	 
  
<160> 1203 



<210> 1 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 1 
uguucacugu ucaaaacga 19 
 
 
<210> 2 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 2 
ucguuuugaa cagugaaca 19 
 
 
<210> 3 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 3 
guucacuguu caaaacgaa 19 
 
 
<210> 4 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 4 
uucguuuuga acagugaac 19 
 
 
<210> 5 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 5 
uucacuguuc aaaacgaag 19 
 
 
<210> 6 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 6 
cuucguuuug aacagugaa 19 
 
 
<210> 7 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 7 
ucauacgaag gauacuuuc 19 
 
 
<210> 8 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 8 
gaaaguaucc uucguauga 19 
 
 
<210> 9 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 9 
cccaggacau gauaauaag 19 
 
 
<210> 10 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 10 
cuuauuauca uguccuggg 19 
 
 
<210> 11 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 11 
guucaaaacg aagacuagc 19 
 
 
<210> 12 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 12 
gcuagucuuc guuuugaac 19 
 
 
<210> 13 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 13 
guauguauaa agauagcca 19 
 
 
<210> 14 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 14 
uggcuaucuu uauacauac 19 
 
 
<210> 15 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 15 
cauugaccaa ggaaaucgg 19 
 
 
<210> 16 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 16 
ccgauuuccu uggucaaug 19 
 
 
<210> 17 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 17 
caaacuauuu gucgcagga 19 
 
 
<210> 18 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 18 
uccugcgaca aauaguuug 19 
 
 
<210> 19 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 19 
acucucuccu gugagaaca 19 
 
 
<210> 20 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 20 
uguucucaca ggagagagu 19 
 
 
<210> 21 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 21 
uuuauugaca auacgcuuu 19 
 
 
<210> 22 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 22 
aaagcguauu gucaauaaa 19 
 
 
<210> 23 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 23 
cuuccucucg caacaaacu 19 
 
 
<210> 24 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 24 
aguuuguugc gagaggaag 19 
 
 
<210> 25 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 25 
gaccauauuu auuauaagu 19 
 
 
<210> 26 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 26 
acuuauaaua aauaugguc 19 
 
 
<210> 27 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 27 
ugaccaagga aaucggccu 19 
 
 
<210> 28 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 28 
aggccgauuu ccuugguca 19 
 
 
<210> 29 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 29 
ucaaaacgaa gacuagcua 19 
 
 
<210> 30 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 30 
uagcuagucu ucguuuuga 19 
 
 
<210> 31 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 31 
gaaucuucau cauacgaag 19 
 
 
<210> 32 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 32 
cuucguauga ugaagauuc 19 
 
 
<210> 33 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 33 
gggauagauc uauaauguu 19 
 
 
<210> 34 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 34 
aacauuauag aucuauccc 19 
 
 
<210> 35 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 35 
cuauuugucg caggaauaa 19 
 
 
<210> 36 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 36 
uuauuccugc gacaaauag 19 
 
 
<210> 37 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 37 
ucuauuugaa gauaugacu 19 
 
 
<210> 38 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 38 
agucauaucu ucaaauaga 19 
 
 
<210> 39 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 39 
caacaaacua uuugucgca 19 
 
 
<210> 40 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 40 
ugcgacaaau aguuuguug 19 
 
 
<210> 41 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 41 
aucuucauca uacgaagga 19 
 
 
<210> 42 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 42 
uccuucguau gaugaagau 19 
 
 
<210> 43 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 43 
cucucgcaac aaacuauuu 19 
 
 
<210> 44 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 44 
aaauaguuug uugcgagag 19 
 
 
<210> 45 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 45 
ugaaucuuca ucauacgaa 19 
 
 
<210> 46 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 46 
uucguaugau gaagauuca 19 
 
 
<210> 47 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 47 
cagaccuucc agaucgcuu 19 
 
 
<210> 48 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 48 
aagcgaucug gaaggucug 19 
 
 
<210> 49 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 49 
cagaucgcuu ccucucgca 19 
 
 
<210> 50 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 50 
ugcgagagga agcgaucug 19 
 
 
<210> 51 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 51 
cuagagguau ggcuguaac 19 
 
 
<210> 52 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 52 
guuacagcca uaccucuag 19 
 
 
<210> 53 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 53 
auuuauugac aauacgcuu 19 
 
 
<210> 54 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 54 
aagcguauug ucaauaaau 19 
 
 
<210> 55 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 55 
acaauacgcu uuacuuuau 19 
 
 
<210> 56 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 56 
auaaaguaaa gcguauugu 19 
 
 
<210> 57 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 57 
acgaaggaua cuuucuagc 19 
 
 
<210> 58 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 58 
gcuagaaagu auccuucgu 19 
 
 
<210> 59 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 59 
ggaauugucu cccagugca 19 
 
 
<210> 60 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 60 
ugcacuggga gacaauucc 19 
 
 
<210> 61 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 61 
cagucuacac agcuucggg 19 
 
 
<210> 62 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 62 
cccgaagcug uguagacug 19 
 
 
<210> 63 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 63 
aucauacgaa ggauacuuu 19 
 
 
<210> 64 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 64 
aaaguauccu ucguaugau 19 
 
 
<210> 65 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 65 
uugaaucuuc aucauacga 19 
 
 
<210> 66 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 66 
ucguaugaug aagauucaa 19 
 
 
<210> 67 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 67 
uuugaaucuu caucauacg 19 
 
 
<210> 68 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 68 
cguaugauga agauucaaa 19 
 
 
<210> 69 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 69 
gaucgcuucc ucucgcaac 19 
 
 
<210> 70 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 70 
guugcgagag gaagcgauc 19 
 
 
<210> 71 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 71 
gagguauggc uguaacuau 19 
 
 
<210> 72 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 72 
auaguuacag ccauaccuc 19 
 
 
<210> 73 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 73 
ucccaggaca ugauaauaa 19 
 
 
<210> 74 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 74 
uuauuaucau guccuggga 19 
 
 
<210> 75 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 75 
ucuacacagc uucgggaag 19 
 
 
<210> 76 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 76 
cuucccgaag cuguguaga 19 
 
 
<210> 77 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 77 
ucucgcaaca aacuauuug 19 
 
 
<210> 78 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 78 
caaauaguuu guugcgaga 19 
 
 
<210> 79 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 79 
gaaucacuug cacuccgga 19 
 
 
<210> 80 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 80 
uccggagugc aagugauuc 19 
 
 
<210> 81 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 81 
ugaaucuaaa uuaucaguc 19 
 
 
<210> 82 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 82 
gacugauaau uuagauuca 19 
 
 
<210> 83 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 83 
gaauccuccu gauaacauc 19 
 
 
<210> 84 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 84 
gauguuauca ggaggauuc 19 
 
 
<210> 85 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 85 
agagguaugg cuguaacua 19 
 
 
<210> 86 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 86 
uaguuacagc cauaccucu 19 
 
 
<210> 87 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 87 
gucccaggac augauaaua 19 
 
 
<210> 88 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 88 
uauuaucaug uccugggac 19 
 
 
<210> 89 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 89 
gauaacauca aggauacaa 19 
 
 
<210> 90 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 90 
uuguauccuu gauguuauc 19 
 
 
<210> 91 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 91 
acaaacuauu ugucgcagg 19 
 
 
<210> 92 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 92 
ccugcgacaa auaguuugu 19 
 
 
<210> 93 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 93 
aaggauacuu ucuagcuug 19 
 
 
<210> 94 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 94 
caagcuagaa aguauccuu 19 
 
 
<210> 95 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 95 
uauuaaaauu ucaugccgg 19 
 
 
<210> 96 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 96 
ccggcaugaa auuuuaaua 19 
 
 
<210> 97 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 97 
uagccagccu agagguaug 19 
 
 
<210> 98 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 98 
cauaccucua ggcuggcua 19 
 
 
<210> 99 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 99 
uggcugcuga accaguaga 19 
 
 
<210> 100 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 100 
ucuacugguu cagcagcca 19 
 
 
<210> 101 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 101 
agaaucacuu gcacuccgg 19 
 
 
<210> 102 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 102 
ccggagugca agugauucu 19 
 
 
<210> 103 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 103 
auuaaaauuu caugccggg 19 
 
 
<210> 104 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 104 
cccggcauga aauuuuaau 19 
 
 
<210> 105 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 105 
ugcagucuac acagcuucg 19 
 
 
<210> 106 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 106 
cgaagcugug uagacugca 19 
 
 
<210> 107 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 107 
gaucuauaau guucacugu 19 
 
 
<210> 108 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 108 
acagugaaca uuauagauc 19 
 
 
<210> 109 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 109 
gcagucuaca cagcuucgg 19 
 
 
<210> 110 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 110 
ccgaagcugu guagacugc 19 
 
 
<210> 111 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 111 
uuaaaauuuc augccgggc 19 
 
 
<210> 112 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 112 
gcccggcaug aaauuuuaa 19 
 
 
<210> 113 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 113 
aacaaacuau uugucgcag 19 
 
 
<210> 114 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 114 
cugcgacaaa uaguuuguu 19 
 
 
<210> 115 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 115 
aauuuauuga caauacgcu 19 
 
 
<210> 116 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 116 
agcguauugu caauaaauu 19 
 
 
<210> 117 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 117 
aaaauuucau gccgggcgc 19 
 
 
<210> 118 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 118 
gcgcccggca ugaaauuuu 19 
 
 
<210> 119 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 119 
guguagugac gcaugcccu 19 
 
 
<210> 120 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 120 
agggcaugcg ucacuacac 19 
 
 
<210> 121 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 121 
aaauuuauug acaauacgc 19 
 
 
<210> 122 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 122 
gcguauuguc aauaaauuu 19 
 
 
<210> 123 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 123 
auugaccaag gaaaucggc 19 
 
 
<210> 124 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 124 
gccgauuucc uuggucaau 19 
 
 
<210> 125 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 125 
uguagugacg caugcccuc 19 
 
 
<210> 126 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 126 
gagggcaugc gucacuaca 19 
 
 
<210> 127 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 127 
ccggaccaua uuuauuaua 19 
 
 
<210> 128 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 128 
uauaauaaau augguccgg 19 
 
 
<210> 129 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 129 
agccagccua gagguaugg 19 
 
 
<210> 130 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 130 
ccauaccucu aggcuggcu 19 
 
 
<210> 131 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 131 
guagugacgc augcccuca 19 
 
 
<210> 132 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 132 
ugagggcaug cgucacuac 19 
 
 
<210> 133 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 133 
gacgcaugcc cucaauccc 19 
 
 
<210> 134 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 134 
gggauugagg gcaugcguc 19 
 
 
<210> 135 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 135 
aaucuucauc auacgaagg 19 
 
 
<210> 136 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 136 
ccuucguaug augaagauu 19 
 
 
<210> 137 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 137 
ggaaaucggc cucuauuug 19 
 
 
<210> 138 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 138 
caaauagagg ccgauuucc 19 
 
 
<210> 139 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 139 
ucagaccuuc cagaucgcu 19 
 
 
<210> 140 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 140 
agcgaucugg aaggucuga 19 
 
 
<210> 141 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 141 
auaugacuga uucugacug 19 
 
 
<210> 142 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 142 
cagucagaau cagucauau 19 
 
 
<210> 143 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 143 
uugcacuccg gagguagag 19 
 
 
<210> 144 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 144 
cucuaccucc ggagugcaa 19 
 
 
<210> 145 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 145 
cuugcacucc ggagguaga 19 
 
 
<210> 146 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 146 
ucuaccuccg gagugcaag 19 
 
 
<210> 147 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 147 
ugacgcaugc ccucaaucc 19 
 
 
<210> 148 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 148 
ggauugaggg caugcguca 19 
 
 
<210> 149 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 149 
uguucacugu ucaaaacgat t 21 
 
 
<210> 150 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 150 
ucguuuugaa cagugaacat t 21 
 
 
<210> 151 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 151 
uguucacugu ucaaaacgat t 21 
 
 
<210> 152 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 152 
ucguuuugaa cagugaacat t 21 
 
 
<210> 153 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 153 
uguucacugu ucaaaacgat t 21 
 
 
<210> 154 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 154 
ucguuuugaa cagugaacat t 21 
 
 
<210> 155 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 155 
uguucacugu ucaaaacgat t 21 
 
 
<210> 156 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 156 
ucguuuugaa cagugaacat t 21 
 
 
<210> 157 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 157 
uguucacugu ucaaaacgat t 21 
 
 
<210> 158 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 11, 14, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 8, 9, 10, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 158 
ucguuuugaa cagugaacat t 21 
 
 
<210> 159 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 159 
tguucacugu ucaaaacgat t 21 
 
 
<210> 160 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 160 
ucguuuugaa cagugaacat t 21 
 
 
<210> 161 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 161 
tguucacugu ucaaaacgat t 21 
 
 
<210> 162 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 162 
ucguuuugaa cagugaacat t 21 
 
 
<210> 163 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 163 
tguucacugu ucaaaacgat t 21 
 
 
<210> 164 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 164 
ucguuuugaa cagugaacat t 21 
 
 
<210> 165 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 165 
tguucacugu ucaaaacgat t 21 
 
 
<210> 166 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 166 
ucguuuugaa cagugaacat t 21 
 
 
<210> 167 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 167 
tguucacugu ucaaaacgat t 21 
 
 
<210> 168 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 11, 14, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 8, 9, 10, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 168 
ucguuuugaa cagugaacat t 21 
 
 
<210> 169 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 169 
uguucacugu ucaaaacgat t 21 
 
 
<210> 170 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 170 
ucguuuugaa cagugaacat t 21 
 
 
<210> 171 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 171 
uguucacugu ucaaaacgat t 21 
 
 
<210> 172 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 172 
ucguuuugaa cagugaacat t 21 
 
 
<210> 173 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 173 
uguucacugu ucaaaacgat t 21 
 
 
<210> 174 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 174 
ucguuuugaa cagugaacat t 21 
 
 
<210> 175 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 175 
uguucacugu ucaaaacgat t 21 
 
 
<210> 176 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 176 
ucguuuugaa cagugaacat t 21 
 
 
<210> 177 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 177 
uguucacugu ucaaaacgat t 21 
 
 
<210> 178 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 11, 14, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 8, 9, 10, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 178 
ucguuuugaa cagugaacat t 21 
 
 
<210> 179 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 9, 10, 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 179 
guucacuguu caaaacgaat t 21 
 
 
<210> 180 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 180 
uucguuuuga acagugaact t 21 
 
 
<210> 181 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9, 10, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 181 
uucacuguuc aaaacgaagt t 21 
 
 
<210> 182 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 182 
cuucguuuug aacagugaat t 21 
 
 
<210> 183 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 8, 9, 10, 11, 12, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 183 
ucauacgaag gauacuuuct t 21 
 
 
<210> 184 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 184 
gaaaguaucc uucguaugat t 21 
 
 
<210> 185 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 185 
cccaggacau gauaauaagt t 21 
 
 
<210> 186 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 186 
cuuauuauca uguccugggt t 21 
 
 
<210> 187 
<211> 22 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 11, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 22 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 12, 13, 15, 16, 18, 19, 20 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 187 
tcccaggaca ugauaauaag tt 22 
 
 
<210> 188 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 188 
cuuauuauca uguccugggt t 21 
 
 
<210> 189 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 189 
guucaaaacg aagacuagct t 21 
 
 
<210> 190 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 190 
gcuagucuuc guuuugaact t 21 
 
 
<210> 191 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 191 
guucaaaacg aagacuagct t 21 
 
 
<210> 192 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 6, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 192 
gcuagucuuc guuuugaact t 21 
 
 
<210> 193 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 193 
guucaaaacg aagacuagct t 21 
 
 
<210> 194 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 6, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 194 
gcuagucuuc guuuugaact t 21 
 
 
<210> 195 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 195 
guucaaaacg aagacuagct t 21 
 
 
<210> 196 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 12, 13, 14, 15, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 11, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 196 
gcuagucuuc guuuugaact t 21 
 
 
<210> 197 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 197 
tuucaaaacg aagacuagct t 21 
 
 
<210> 198 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 198 
gcuagucuuc guuuugaact t 21 
 
 
<210> 199 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 199 
tuucaaaacg aagacuagct t 21 
 
 
<210> 200 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 6, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 200 
gcuagucuuc guuuugaact t 21 
 
 
<210> 201 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 201 
tuucaaaacg aagacuagct t 21 
 
 
<210> 202 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 6, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 202 
gcuagucuuc guuuugaact t 21 
 
 
<210> 203 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 203 
tuucaaaacg aagacuagct t 21 
 
 
<210> 204 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 12, 13, 14, 15, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 11, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 204 
gcuagucuuc guuuugaact t 21 
 
 
<210> 205 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 205 
guucaaaacg aagacuagct t 21 
 
 
<210> 206 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 206 
gcuagucuuc guuuugaact t 21 
 
 
<210> 207 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 207 
guucaaaacg aagacuagct t 21 
 
 
<210> 208 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 6, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 208 
gcuagucuuc guuuugaact t 21 
 
 
<210> 209 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 209 
guucaaaacg aagacuagct t 21 
 
 
<210> 210 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 6, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 210 
gcuagucuuc guuuugaact t 21 
 
 
<210> 211 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 15, 16, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 211 
guucaaaacg aagacuagct t 21 
 
 
<210> 212 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 12, 13, 14, 15, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 11, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 212 
gcuagucuuc guuuugaact t 21 
 
 
<210> 213 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 213 
guauguauaa agauagccat t 21 
 
 
<210> 214 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 214 
uggcuaucuu uauacauact t 21 
 
 
<210> 215 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 9, 10, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 215 
cauugaccaa ggaaaucggt t 21 
 
 
<210> 216 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 216 
ccgauuuccu uggucaaugt t 21 
 
 
<210> 217 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 217 
caaacuauuu gucgcaggat t 21 
 
 
<210> 218 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 218 
uccugcgaca aauaguuugt t 21 
 
 
<210> 219 
<211> 22 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 9, 10, 11, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 22 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 12, 15, 17, 18, 19, 20 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 219 
tcaaacuauu ugucgcagga tt 22 
 
 
<210> 220 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 9, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 220 
uccugcgaca aauaguuugt t 21 
 
 
<210> 221 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 221 
acucucuccu gugagaacat t 21 
 
 
<210> 222 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 222 
uguucucaca ggagagagut t 21 
 
 
<210> 223 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 223 
acucucuccu gugagaacat t 21 
 
 
<210> 224 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 224 
uguucucaca ggagagagut t 21 
 
 
<210> 225 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 225 
acucucuccu gugagaacat t 21 
 
 
<210> 226 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 226 
uguucucaca ggagagagut t 21 
 
 
<210> 227 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 227 
acucucuccu gugagaacat t 21 
 
 
<210> 228 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 228 
uguucucaca ggagagagut t 21 
 
 
<210> 229 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 229 
acucucuccu gugagaacat t 21 
 
 
<210> 230 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 230 
uguucucaca ggagagagut t 21 
 
 
<210> 231 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 231 
acucucuccu gugagaacat t 21 
 
 
<210> 232 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 232 
uguucucaca ggagagagut t 21 
 
 
<210> 233 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 233 
acucucuccu gugagaacat t 21 
 
 
<210> 234 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 234 
uguucucaca ggagagagut t 21 
 
 
<210> 235 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 235 
acucucuccu gugagaacat t 21 
 
 
<210> 236 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 236 
uguucucaca ggagagagut t 21 
 
 
<210> 237 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 237 
acucucuccu gugagaacat t 21 
 
 
<210> 238 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 238 
uguucucaca ggagagagut t 21 
 
 
<210> 239 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 239 
tcucucuccu gugagaacat t 21 
 
 
<210> 240 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 240 
uguucucaca ggagagagut t 21 
 
 
<210> 241 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 241 
tcucucuccu gugagaacat t 21 
 
 
<210> 242 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 242 
uguucucaca ggagagagut t 21 
 
 
<210> 243 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 243 
acucucuccu gugagaacat t 21 
 
 
<210> 244 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 244 
uguucucaca ggagagagut t 21 
 
 
<210> 245 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 245 
acucucuccu gugagaacat t 21 
 
 
<210> 246 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 246 
uguucucaca ggagagagut t 21 
 
 
<210> 247 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 247 
uuuauugaca auacgcuuut t 21 
 
 
<210> 248 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 248 
aaagcguauu gucaauaaat t 21 
 
 
<210> 249 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 10, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 249 
cuuccucucg caacaaacut t 21 
 
 
<210> 250 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 250 
aguuuguugc gagaggaagt t 21 
 
 
<210> 251 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 8, 9, 10, 12, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 11, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 251 
gaccauauuu auuauaagut t 21 
 
 
<210> 252 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 252 
acuuauaaua aauaugguct t 21 
 
 
<210> 253 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 253 
ugaccaagga aaucggccut t 21 
 
 
<210> 254 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 254 
aggccgauuu ccuuggucat t 21 
 
 
<210> 255 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 255 
ugaccaagga aaucggccut t 21 
 
 
<210> 256 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 8, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 256 
aggccgauuu ccuuggucat t 21 
 
 
<210> 257 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 257 
ugaccaagga aaucggccut t 21 
 
 
<210> 258 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 258 
aggccgauuu ccuuggucat t 21 
 
 
<210> 259 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 259 
ugaccaagga aaucggccut t 21 
 
 
<210> 260 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 9, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 260 
aggccgauuu ccuuggucat t 21 
 
 
<210> 261 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 261 
tgaccaagga aaucggccut t 21 
 
 
<210> 262 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 262 
aggccgauuu ccuuggucat t 21 
 
 
<210> 263 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 263 
tgaccaagga aaucggccut t 21 
 
 
<210> 264 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 8, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 264 
aggccgauuu ccuuggucat t 21 
 
 
<210> 265 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 265 
tgaccaagga aaucggccut t 21 
 
 
<210> 266 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 266 
aggccgauuu ccuuggucat t 21 
 
 
<210> 267 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 267 
tgaccaagga aaucggccut t 21 
 
 
<210> 268 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 9, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 268 
aggccgauuu ccuuggucat t 21 
 
 
<210> 269 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 269 
ugaccaagga aaucggccut t 21 
 
 
<210> 270 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 270 
aggccgauuu ccuuggucat t 21 
 
 
<210> 271 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 271 
ugaccaagga aaucggccut t 21 
 
 
<210> 272 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 8, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 272 
aggccgauuu ccuuggucat t 21 
 
 
<210> 273 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 273 
ugaccaagga aaucggccut t 21 
 
 
<210> 274 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 274 
aggccgauuu ccuuggucat t 21 
 
 
<210> 275 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 275 
ugaccaagga aaucggccut t 21 
 
 
<210> 276 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 9, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 276 
aggccgauuu ccuuggucat t 21 
 
 
<210> 277 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 13, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 8, 9, 10, 11, 12, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 277 
ucaaaacgaa gacuagcuat t 21 
 
 
<210> 278 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 278 
uagcuagucu ucguuuugat t 21 
 
 
<210> 279 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 279 
gaaucuucau cauacgaagt t 21 
 
 
<210> 280 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 280 
cuucguauga ugaagauuct t 21 
 
 
<210> 281 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 281 
gaaucuucau cauacgaagt t 21 
 
 
<210> 282 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 282 
cuucguauga ugaagauuct t 21 
 
 
<210> 283 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 283 
gaaucuucau cauacgaagt t 21 
 
 
<210> 284 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 284 
cuucguauga ugaagauuct t 21 
 
 
<210> 285 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 285 
gaaucuucau cauacgaagt t 21 
 
 
<210> 286 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 11, 17, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 7, 9, 10, 12, 13, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 286 
cuucguauga ugaagauuct t 21 
 
 
<210> 287 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 287 
taaucuucau cauacgaagt t 21 
 
 
<210> 288 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 288 
cuucguauga ugaagauuct t 21 
 
 
<210> 289 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 289 
taaucuucau cauacgaagt t 21 
 
 
<210> 290 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 290 
cuucguauga ugaagauuct t 21 
 
 
<210> 291 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 291 
taaucuucau cauacgaagt t 21 
 
 
<210> 292 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 292 
cuucguauga ugaagauuct t 21 
 
 
<210> 293 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 293 
taaucuucau cauacgaagt t 21 
 
 
<210> 294 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 11, 17, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 7, 9, 10, 12, 13, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 294 
cuucguauga ugaagauuct t 21 
 
 
<210> 295 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 295 
gaaucuucau cauacgaagt t 21 
 
 
<210> 296 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 296 
cuucguauga ugaagauuct t 21 
 
 
<210> 297 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 297 
gaaucuucau cauacgaagt t 21 
 
 
<210> 298 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 298 
cuucguauga ugaagauuct t 21 
 
 
<210> 299 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 299 
gaaucuucau cauacgaagt t 21 
 
 
<210> 300 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 300 
cuucguauga ugaagauuct t 21 
 
 
<210> 301 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 301 
gaaucuucau cauacgaagt t 21 
 
 
<210> 302 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 11, 17, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 7, 9, 10, 12, 13, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 302 
cuucguauga ugaagauuct t 21 
 
 
<210> 303 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 10, 11, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 12, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 303 
gggauagauc uauaauguut t 21 
 
 
<210> 304 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 304 
aacauuauag aucuauccct t 21 
 
 
<210> 305 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 7, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 305 
cuauuugucg caggaauaat t 21 
 
 
<210> 306 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 306 
uuauuccugc gacaaauagt t 21 
 
 
<210> 307 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 307 
ucuauuugaa gauaugacut t 21 
 
 
<210> 308 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 308 
agucauaucu ucaaauagat t 21 
 
 
<210> 309 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 309 
ucuauuugaa gauaugacut t 21 
 
 
<210> 310 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 6, 10, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 310 
agucauaucu ucaaauagat t 21 
 
 
<210> 311 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 311 
ucuauuugaa gauaugacut t 21 
 
 
<210> 312 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 8, 9, 10, 11, 12, 16 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 312 
agucauaucu ucaaauagat t 21 
 
 
<210> 313 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 313 
tcuauuugaa gauaugacut t 21 
 
 
<210> 314 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 314 
agucauaucu ucaaauagat t 21 
 
 
<210> 315 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 315 
tcuauuugaa gauaugacut t 21 
 
 
<210> 316 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 6, 10, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 316 
agucauaucu ucaaauagat t 21 
 
 
<210> 317 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "5'-O-methyl-thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 317 
tcuauuugaa gauaugacut t 21 
 
 
<210> 318 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 8, 9, 10, 11, 12, 16 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 318 
agucauaucu ucaaauagat t 21 
 
 
<210> 319 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 319 
ucuauuugaa gauaugacut t 21 
 
 
<210> 320 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 320 
agucauaucu ucaaauagat t 21 
 
 
<210> 321 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 321 
ucuauuugaa gauaugacut t 21 
 
 
<210> 322 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 6, 10, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 322 
agucauaucu ucaaauagat t 21 
 
 
<210> 323 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 323 
ucuauuugaa gauaugacut t 21 
 
 
<210> 324 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 8, 9, 10, 11, 12, 16 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 324 
agucauaucu ucaaauagat t 21 
 
 
<210> 325 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 8, 9, 11, 12, 13, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 10, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 325 
caacaaacua uuugucgcat t 21 
 
 
<210> 326 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 326 
ugcgacaaau aguuuguugt t 21 
 
 
<210> 327 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 11, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 327 
aucuucauca uacgaaggat t 21 
 
 
<210> 328 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 328 
uccuucguau gaugaagaut t 21 
 
 
<210> 329 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 10, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 8, 9, 11, 12, 13, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 329 
cucucgcaac aaacuauuut t 21 
 
 
<210> 330 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 330 
aaauaguuug uugcgagagt t 21 
 
 
<210> 331 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 9, 11, 12, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 10, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 331 
ugaaucuuca ucauacgaat t 21 
 
 
<210> 332 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 332 
uucguaugau gaagauucat t 21 
 
 
<210> 333 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 9, 10, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 11, 12, 13, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 333 
cagaccuucc agaucgcuut t 21 
 
 
<210> 334 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 334 
aagcgaucug gaaggucugt t 21 
 
 
<210> 335 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 335 
cagaucgcuu ccucucgcat t 21 
 
 
<210> 336 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 336 
ugcgagagga agcgaucugt t 21 
 
 
<210> 337 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 10, 13, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 9, 11, 12, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 337 
cuagagguau ggcuguaact t 21 
 
 
<210> 338 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 9, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 338 
guuacagcca uaccucuagt t 21 
 
 
<210> 339 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 10, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 11, 12, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 339 
auuuauugac aauacgcuut t 21 
 
 
<210> 340 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 340 
aagcguauug ucaauaaaut t 21 
 
 
<210> 341 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 9, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 13, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 341 
acaauacgcu uuacuuuaut t 21 
 
 
<210> 342 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 342 
auaaaguaaa gcguauugut t 21 
 
 
<210> 343 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 11, 12, 13, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 343 
acgaaggaua cuuucuagct t 21 
 
 
<210> 344 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 344 
gcuagaaagu auccuucgut t 21 
 
 
<210> 345 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 8, 9, 10, 11, 12, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 345 
ggaauugucu cccagugcat t 21 
 
 
<210> 346 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 346 
ugcacuggga gacaauucct t 21 
 
 
<210> 347 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 8, 10, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 9, 11, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 347 
cagucuacac agcuucgggt t 21 
 
 
<210> 348 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 348 
cccgaagcug uguagacugt t 21 
 
 
<210> 349 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 8, 9, 10, 11, 12, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 349 
aucauacgaa ggauacuuut t 21 
 
 
<210> 350 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 350 
aaaguauccu ucguaugaut t 21 
 
 
<210> 351 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 9, 10, 12, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 11, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 351 
uugaaucuuc aucauacgat t 21 
 
 
<210> 352 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 352 
ucguaugaug aagauucaat t 21 
 
 
<210> 353 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 8, 9, 10, 11, 13, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 12, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 353 
uuugaaucuu caucauacgt t 21 
 
 
<210> 354 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 354 
cguaugauga agauucaaat t 21 
 
 
<210> 355 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 355 
gaucgcuucc ucucgcaact t 21 
 
 
<210> 356 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 356 
guugcgagag gaagcgauct t 21 
 
 
<210> 357 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7, 10, 11, 13, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 9, 12, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 357 
gagguauggc uguaacuaut t 21 
 
 
<210> 358 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 9, 10, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 358 
auaguuacag ccauaccuct t 21 
 
 
<210> 359 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 9, 11, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 359 
ucccaggaca ugauaauaat t 21 
 
 
<210> 360 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 360 
uuauuaucau guccugggat t 21 
 
 
<210> 361 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 10, 11, 12, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 8, 9, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 361 
ucuacacagc uucgggaagt t 21 
 
 
<210> 362 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 362 
cuucccgaag cuguguagat t 21 
 
 
<210> 363 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 9, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 7, 8, 10, 11, 12, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 363 
ucucgcaaca aacuauuugt t 21 
 
 
<210> 364 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 364 
caaauaguuu guugcgagat t 21 
 
 
<210> 365 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 8, 9, 11, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 10, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 365 
gaaucacuug cacuccggat t 21 
 
 
<210> 366 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 366 
uccggagugc aagugauuct t 21 
 
 
<210> 367 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 11, 12, 14, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 8, 9, 10, 13, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 367 
ugaaucuaaa uuaucaguct t 21 
 
 
<210> 368 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 368 
gacugauaau uuagauucat t 21 
 
 
<210> 369 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 9, 10, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 11, 12, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 369 
gaauccuccu gauaacauct t 21 
 
 
<210> 370 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 370 
gauguuauca ggaggauuct t 21 
 
 
<210> 371 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 8, 11, 12, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 9, 10, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 371 
agagguaugg cuguaacuat t 21 
 
 
<210> 372 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 11, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 372 
uaguuacagc cauaccucut t 21 
 
 
<210> 373 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 10, 12, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 9, 11, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 373 
gucccaggac augauaauat t 21 
 
 
<210> 374 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 374 
uauuaucaug uccugggact t 21 
 
 
<210> 375 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 9, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 375 
gauaacauca aggauacaat t 21 
 
 
<210> 376 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 376 
uuguauccuu gauguuauct t 21 
 
 
<210> 377 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 9, 10, 11, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 8, 12, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 377 
acaaacuauu ugucgcaggt t 21 
 
 
<210> 378 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 378 
ccugcgacaa auaguuugut t 21 
 
 
<210> 379 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 8, 9, 10, 11, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 14, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 379 
aaggauacuu ucuagcuugt t 21 
 
 
<210> 380 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 380 
caagcuagaa aguauccuut t 21 
 
 
<210> 381 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 13, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 381 
uauuaaaauu ucaugccggt t 21 
 
 
<210> 382 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 382 
ccggcaugaa auuuuaauat t 21 
 
 
<210> 383 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 8, 9, 10, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 383 
uagccagccu agagguaugt t 21 
 
 
<210> 384 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 9, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 384 
cauaccucua ggcuggcuat t 21 
 
 
<210> 385 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 8, 12, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 9, 10, 11, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 385 
uggcugcuga accaguagat t 21 
 
 
<210> 386 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 11, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 386 
ucuacugguu cagcagccat t 21 
 
 
<210> 387 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 8, 9, 10, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 11, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 387 
agaaucacuu gcacuccggt t 21 
 
 
<210> 388 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 388 
ccggagugca agugauucut t 21 
 
 
<210> 389 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 8, 9, 10, 11, 13, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 12, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 389 
auuaaaauuu caugccgggt t 21 
 
 
<210> 390 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 390 
cccggcauga aauuuuaaut t 21 
 
 
<210> 391 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 8, 10, 12, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 9, 11, 13, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 391 
ugcagucuac acagcuucgt t 21 
 
 
<210> 392 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 392 
cgaagcugug uagacugcat t 21 
 
 
<210> 393 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 10, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 8, 9, 11, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 393 
gaucuauaau guucacugut t 21 
 
 
<210> 394 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 394 
acagugaaca uuauagauct t 21 
 
 
<210> 395 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 9, 11, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 8, 10, 12, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 395 
gcagucuaca cagcuucggt t 21 
 
 
<210> 396 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 396 
ccgaagcugu guagacugct t 21 
 
 
<210> 397 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 8, 9, 10, 12, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 11, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 397 
uuaaaauuuc augccgggct t 21 
 
 
<210> 398 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 398 
gcccggcaug aaauuuuaat t 21 
 
 
<210> 399 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 8, 10, 11, 12, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 9, 13, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 399 
aacaaacuau uugucgcagt t 21 
 
 
<210> 400 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 400 
cugcgacaaa uaguuuguut t 21 
 
 
<210> 401 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 11, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 9, 10, 12, 13, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 401 
aauuuauuga caauacgcut t 21 
 
 
<210> 402 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 402 
agcguauugu caauaaauut t 21 
 
 
<210> 403 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 12, 13, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 9, 11, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 403 
aaaauuucau gccgggcgct t 21 
 
 
<210> 404 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 404 
gcgcccggca ugaaauuuut t 21 
 
 
<210> 405 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 10, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 9, 11, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 405 
guguagugac gcaugcccut t 21 
 
 
<210> 406 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 12, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 406 
agggcaugcg ucacuacact t 21 
 
 
<210> 407 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 9, 12, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 10, 11, 13, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 407 
aaauuuauug acaauacgct t 21 
 
 
<210> 408 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 408 
gcguauuguc aauaaauuut t 21 
 
 
<210> 409 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 8, 9, 10, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 409 
auugaccaag gaaaucggct t 21 
 
 
<210> 410 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 410 
gccgauuucc uuggucaaut t 21 
 
 
<210> 411 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 9, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 8, 10, 12, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 411 
uguagugacg caugcccuct t 21 
 
 
<210> 412 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 412 
gagggcaugc gucacuacat t 21 
 
 
<210> 413 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 9, 11, 12, 13, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 10, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 413 
ccggaccaua uuuauuauat t 21 
 
 
<210> 414 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 414 
uauaauaaau augguccggt t 21 
 
 
<210> 415 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 8, 9, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 415 
agccagccua gagguauggt t 21 
 
 
<210> 416 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 416 
ccauaccucu aggcuggcut t 21 
 
 
<210> 417 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8, 10, 12, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 9, 11, 13, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 417 
guagugacgc augcccucat t 21 
 
 
<210> 418 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 418 
ugagggcaug cgucacuact t 21 
 
 
<210> 419 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 9, 10, 11, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 8, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 419 
gacgcaugcc cucaauccct t 21 
 
 
<210> 420 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 420 
gggauugagg gcaugcguct t 21 
 
 
<210> 421 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 9, 10, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 421 
aaucuucauc auacgaaggt t 21 
 
 
<210> 422 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 422 
ccuucguaug augaagauut t 21 
 
 
<210> 423 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 7, 10, 11, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 8, 9, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 423 
ggaaaucggc cucuauuugt t 21 
 
 
<210> 424 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 424 
caaauagagg ccgauuucct t 21 
 
 
<210> 425 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 9, 10, 11, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 12, 13, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 425 
ucagaccuuc cagaucgcut t 21 
 
 
<210> 426 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 426 
agcgaucugg aaggucugat t 21 
 
 
<210> 427 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 8, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 9, 10, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 427 
auaugacuga uucugacugt t 21 
 
 
<210> 428 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 428 
cagucagaau cagucauaut t 21 
 
 
<210> 429 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 9, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 429 
uugcacuccg gagguagagt t 21 
 
 
<210> 430 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 430 
cucuaccucc ggagugcaat t 21 
 
 
<210> 431 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 431 
cuugcacucc ggagguagat t 21 
 
 
<210> 432 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 432 
ucuaccuccg gagugcaagt t 21 
 
 
<210> 433 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 8, 10, 11, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 9, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 433 
ugacgcaugc ccucaaucct t 21 
 
 
<210> 434 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 434 
ggauugaggg caugcgucat t 21 
 
 
<210> 435 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 8, 9, 10, 11, 12, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 435 
ucauacgaag gauacuuuct t 21 
 
 
<210> 436 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 436 
gaaaguaucc uucguaugat t 21 
 
 
<210> 437 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 8, 9, 10, 11, 12, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 437 
ucauacgaag gauacuuuct t 21 
 
 
<210> 438 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 438 
gaaaguaucc uucguaugat t 21 
 
 
<210> 439 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 8, 9, 10, 11, 12, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 439 
ucauacgaag gauacuuuct t 21 
 
 
<210> 440 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 8, 9, 10, 11, 12, 13, 15, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 440 
gaaaguaucc uucguaugat t 21 
 
 
<210> 441 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 9, 10, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 441 
cauugaccaa ggaaaucggt t 21 
 
 
<210> 442 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 442 
ccgauuuccu uggucaaugt t 21 
 
 
<210> 443 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 9, 10, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 443 
cauugaccaa ggaaaucggt t 21 
 
 
<210> 444 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 15, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 444 
ccgauuuccu uggucaaugt t 21 
 
 
<210> 445 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 9, 10, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 445 
cauugaccaa ggaaaucggt t 21 
 
 
<210> 446 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 446 
ccgauuuccu uggucaaugt t 21 
 
 
<210> 447 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 9, 10, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 447 
cauugaccaa ggaaaucggt t 21 
 
 
<210> 448 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 15, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 448 
ccgauuuccu uggucaaugt t 21 
 
 
<210> 449 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 9, 10, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 449 
cauugaccaa ggaaaucggt t 21 
 
 
<210> 450 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 8, 9, 10, 11, 14, 15, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 450 
ccgauuuccu uggucaaugt t 21 
 
 
<210> 451 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 451 
cccaggacau gauaauaagt t 21 
 
 
<210> 452 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 8, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 452 
cuuauuauca uguccugggt t 21 
 
 
<210> 453 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 453 
cccaggacau gauaauaagt t 21 
 
 
<210> 454 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 8, 9 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 454 
cuuauuauca uguccugggt t 21 
 
 
<210> 455 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 455 
cccaggacau gauaauaagt t 21 
 
 
<210> 456 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 456 
cuuauuauca uguccugggt t 21 
 
 
<210> 457 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 457 
cccaggacau gauaauaagt t 21 
 
 
<210> 458 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 458 
cuuauuauca uguccugggt t 21 
 
 
<210> 459 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 459 
cccaggacau gauaauaagt t 21 
 
 
<210> 460 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 460 
cuuauuauca uguccugggt t 21 
 
 
<210> 461 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 461 
cccaggacau gauaauaagt t 21 
 
 
<210> 462 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 462 
cuuauuauca uguccugggt t 21 
 
 
<210> 463 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 463 
cccaggacau gauaauaagt t 21 
 
 
<210> 464 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9, 11, 13, 14, 15, 16 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 10, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 464 
cuuauuauca uguccugggt t 21 
 
 
<210> 465 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 465 
caaacuauuu gucgcaggat t 21 
 
 
<210> 466 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 9, 13, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 466 
uccugcgaca aauaguuugt t 21 
 
 
<210> 467 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 467 
caaacuauuu gucgcaggat t 21 
 
 
<210> 468 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 9, 13, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 468 
uccugcgaca aauaguuugt t 21 
 
 
<210> 469 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 469 
caaacuauuu gucgcaggat t 21 
 
 
<210> 470 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 9, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 470 
uccugcgaca aauaguuugt t 21 
 
 
<210> 471 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 471 
caaacuauuu gucgcaggat t 21 
 
 
<210> 472 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 9, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 472 
uccugcgaca aauaguuugt t 21 
 
 
<210> 473 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 473 
caaacuauuu gucgcaggat t 21 
 
 
<210> 474 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 13, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 474 
uccugcgaca aauaguuugt t 21 
 
 
<210> 475 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 475 
caaacuauuu gucgcaggat t 21 
 
 
<210> 476 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 13, 18 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 476 
uccugcgaca aauaguuugt t 21 
 
 
<210> 477 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 477 
caaacuauuu gucgcaggat t 21 
 
 
<210> 478 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 478 
uccugcgaca aauaguuugt t 21 
 
 
<210> 479 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 479 
caaacuauuu gucgcaggat t 21 
 
 
<210> 480 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 480 
uccugcgaca aauaguuugt t 21 
 
 
<210> 481 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 481 
guauguauaa agauagccat t 21 
 
 
<210> 482 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 482 
uggcuaucuu uauacauact t 21 
 
 
<210> 483 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 483 
guauguauaa agauagccat t 21 
 
 
<210> 484 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 484 
uggcuaucuu uauacauact t 21 
 
 
<210> 485 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 485 
guauguauaa agauagccat t 21 
 
 
<210> 486 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 486 
uggcuaucuu uauacauact t 21 
 
 
<210> 487 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 487 
guauguauaa agauagccat t 21 
 
 
<210> 488 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 488 
uggcuaucuu uauacauact t 21 
 
 
<210> 489 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 489 
guauguauaa agauagccat t 21 
 
 
<210> 490 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 490 
uggcuaucuu uauacauact t 21 
 
 
<210> 491 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 491 
guauguauaa agauagccat t 21 
 
 
<210> 492 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 492 
uggcuaucuu uauacauact t 21 
 
 
<210> 493 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 493 
guauguauaa agauagccat t 21 
 
 
<210> 494 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 494 
uggcuaucuu uauacauact t 21 
 
 
<210> 495 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 495 
guauguauaa agauagccat t 21 
 
 
<210> 496 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 496 
uggcuaucuu uauacauact t 21 
 
 
<210> 497 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 497 
guauguauaa agauagccat t 21 
 
 
<210> 498 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5, 9, 11, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 10, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 498 
uggcuaucuu uauacauact t 21 
 
 
<210> 499 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 499 
guauguauaa agauagccat t 21 
 
 
<210> 500 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5, 10, 11, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 500 
uggcuaucuu uauacauact t 21 
 
 
<210> 501 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 501 
guauguauaa agauagccat t 21 
 
 
<210> 502 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5, 9, 10, 11, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 502 
uggcuaucuu uauacauact t 21 
 
 
<210> 503 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 503 
acucucuccu gugagaacat t 21 
 
 
<210> 504 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 504 
uguucucaca ggagagagut t 21 
 
 
<210> 505 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 505 
acucucuccu gugagaacat t 21 
 
 
<210> 506 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 506 
uguucucaca ggagagagut t 21 
 
 
<210> 507 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 507 
acucucuccu gugagaacat t 21 
 
 
<210> 508 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 508 
uguucucaca ggagagagut t 21 
 
 
<210> 509 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 509 
acucucuccu gugagaacat t 21 
 
 
<210> 510 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 510 
uguucucaca ggagagagut t 21 
 
 
<210> 511 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 511 
acucucuccu gugagaacat t 21 
 
 
<210> 512 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 512 
uguucucaca ggagagagut t 21 
 
 
<210> 513 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 513 
acucucuccu gugagaacat t 21 
 
 
<210> 514 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 514 
uguucucaca ggagagagut t 21 
 
 
<210> 515 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 515 
acucucuccu gugagaacat t 21 
 
 
<210> 516 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 516 
uguucucaca ggagagagut t 21 
 
 
<210> 517 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 517 
acucucuccu gugagaacat t 21 
 
 
<210> 518 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 518 
uguucucaca ggagagagut t 21 
 
 

<210> 519 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 519 
uguucgagga uaugacuga 19 
 
 
<210> 520 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 520 
ucagucauau ccucgaaca 19 
 
 
<210> 521 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 521 
uucacuguac aaccgcagu 19 
 
 
<210> 522 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 522 
acugcgguug uacagugaa 19 
 
 
<210> 523 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 523 
ucucuucguu gacaaaaga 19 
 
 
<210> 524 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 524 
ucuuuuguca acgaagaga 19 
 
 
<210> 525 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 525 
uaguaaaaug ucuacccuc 19 
 
 
<210> 526 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 526 
gaggguagac auuuuacua 19 
 
 
<210> 527 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 527 
ucagaagacu cuugcguca 19 
 
 
<210> 528 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 528 
ugacgcaaga gucuucuga 19 
 
 
<210> 529 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 529 
cgcuuuacuu uauaccuga 19 
 
 
<210> 530 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 530 
ucagguauaa aguaaagcg 19 
 
 
<210> 531 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 531 
accagacuga uaauauaca 19 
 
 
<210> 532 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 532 
uguauauuau cagucuggu 19 
 
 
<210> 533 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 533 
aaagacagcc uguguucga 19 
 
 
<210> 534 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 534 
ucgaacacag gcugucuuu 19 
 
 
<210> 535 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 535 
cugugaagga uaguaaaau 19 
 
 
<210> 536 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 536 
auuuuacuau ccuucacag 19 
 
 
<210> 537 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 537 
uuuauugaca acacgcuuu 19 
 
 
<210> 538 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 538 
aaagcguguu gucaauaaa 19 
 
 
<210> 539 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 539 
ccauaacaga auacccgag 19 
 
 
<210> 540 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 540 
cucggguauu cuguuaugg 19 
 
 
<210> 541 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 541 
ucaaggaaau gauguuuau 19 
 
 
<210> 542 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 542 
auaaacauca uuuccuuga 19 
 
 
<210> 543 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 543 
acuucacugu acaaccgca 19 
 
 
<210> 544 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 544 
ugcgguugua cagugaagu 19 
 
 
<210> 545 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 545 
accgcaguaa uacggaaua 19 
 
 
<210> 546 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 546 
uauuccguau uacugcggu 19 
 
 
<210> 547 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 547 
aaagugaucu cauauucuu 19 
 
 
<210> 548 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 548 
aagaauauga gaucacuuu 19 
 
 
<210> 549 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 549 
aggaagauga ugcuuucaa 19 
 
 
<210> 550 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 550 
uugaaagcau caucuuccu 19 
 
 
<210> 551 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 551 
caaagaaagc cgccucaaa 19 
 
 
<210> 552 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 552 
uuugaggcgg cuuucuuug 19 
 
 
<210> 553 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 553 
ugauguuuau ugacaacac 19 
 
 
<210> 554 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 554 
guguugucaa uaaacauca 19 
 
 
<210> 555 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 555 
uguucacucu cacuaacuu 19 
 
 
<210> 556 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 556 
aaguuaguga gagugaaca 19 
 
 
<210> 557 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 557 
ggacaaagaa agccgccuc 19 
 
 
<210> 558 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 558 
gaggcggcuu ucuuugucc 19 
 
 
<210> 559 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 559 
caaccgcagu aauacggaa 19 
 
 
<210> 560 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 560 
uuccguauua cugcgguug 19 
 
 
<210> 561 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 561 
aagaaagccg ccucaaacc 19 
 
 
<210> 562 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 562 
gguuugaggc ggcuuucuu 19 
 
 
<210> 563 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 563 
aucucauauu cuuucagaa 19 
 
 
<210> 564 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 564 
uucugaaaga auaugagau 19 
 
 
<210> 565 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 565 
auaacagaau acccgaggc 19 
 
 
<210> 566 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 566 
gccucgggua uucuguuau 19 
 
 
<210> 567 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 567 
gccuguguuc gaggauaug 19 
 
 
<210> 568 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 568 
cauauccucg aacacaggc 19 
 
 
<210> 569 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 569 
uuauugacaa cacgcuuua 19 
 
 
<210> 570 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 570 
uaaagcgugu ugucaauaa 19 
 
 
<210> 571 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 571 
acucucacua acuuacauc 19 
 
 
<210> 572 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 572 
gauguaaguu agugagagu 19 
 
 
<210> 573 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 573 
cugcaugauu uauagagua 19 
 
 
<210> 574 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 574 
uacucuauaa aucaugcag 19 
 
 
<210> 575 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 575 
ccgcaguaau acggaauau 19 
 
 
<210> 576 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 576 
auauuccgua uuacugcgg 19 
 
 
<210> 577 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 577 
acaugcgccu ugugaugac 19 
 
 
<210> 578 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 578 
gucaucacaa ggcgcaugu 19 
 
 
<210> 579 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 579 
uuccauaaca gaauacccg 19 
 
 
<210> 580 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 580 
cggguauucu guuauggaa 19 
 
 
<210> 581 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 581 
auacaaagug aucucauau 19 
 
 
<210> 582 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 582 
auaugagauc acuuuguau 19 
 
 
<210> 583 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 583 
cagaagacuc uugcgucaa 19 
 
 
<210> 584 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 584 
uugacgcaag agucuucug 19 
 
 
<210> 585 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 585 
uuccagaaag augauuagc 19 
 
 
<210> 586 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 586 
gcuaaucauc uuucuggaa 19 
 
 
<210> 587 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 587 
uaugacugau auugaucaa 19 
 
 
<210> 588 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 588 
uugaucaaua ucagucaua 19 
 
 
<210> 589 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 589 
ggcugcauga uuuauagag 19 
 
 
<210> 590 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 590 
cucuauaaau caugcagcc 19 
 
 
<210> 591 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 591 
ccgacuucac uguacaacc 19 
 
 
<210> 592 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 592 
gguuguacag ugaagucgg 19 
 
 
<210> 593 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 593 
auaguaaaau gucuacccu 19 
 
 
<210> 594 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 594 
aggguagaca uuuuacuau 19 
 
 
<210> 595 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 595 
ugacugauau ugaucaaag 19 
 
 
<210> 596 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 596 
cuuugaucaa uaucaguca 19 
 
 
<210> 597 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 597 
cuugugauga ccucgccug 19 
 
 
<210> 598 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 598 
caggcgaggu caucacaag 19 
 
 
<210> 599 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 599 
ucgaggauau gacugauau 19 
 
 
<210> 600 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 600 
auaucaguca uauccucga 19 
 
 
<210> 601 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 601 
gaugaccucg ccuguauuu 19 
 
 
<210> 602 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 602 
aaauacaggc gaggucauc 19 
 
 
<210> 603 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 603 
agaguaaaca cguuuauuu 19 
 
 
<210> 604 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 604 
aaauaaacgu guuuacucu 19 
 
 
<210> 605 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 605 
ccucucugug aaggauagu 19 
 
 
<210> 606 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 606 
acuauccuuc acagagagg 19 
 
 
<210> 607 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 607 
augauguuua uugacaaca 19 
 
 
<210> 608 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 608 
uguugucaau aaacaucau 19 
 
 
<210> 609 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 609 
agacaacuuu ggccgacuu 19 
 
 
<210> 610 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 610 
aagucggcca aaguugucu 19 
 
 
<210> 611 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 611 
uccauaacag aauacccga 19 
 
 
<210> 612 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 612 
ucggguauuc uguuaugga 19 
 
 
<210> 613 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 613 
guacaaccgc aguaauacg 19 
 
 
<210> 614 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 614 
cguauuacug cgguuguac 19 
 
 
<210> 615 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 615 
ugauuagcac acaugcgcc 19 
 
 
<210> 616 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 616 
ggcgcaugug ugcuaauca 19 
 
 
<210> 617 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 617 
augauuagca cacaugcgc 19 
 
 
<210> 618 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 618 
gcgcaugugu gcuaaucau 19 
 
 
<210> 619 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 619 
gcuuuacuuu auaccugaa 19 
 
 
<210> 620 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 620 
uucagguaua aaguaaagc 19 
 
 
<210> 621 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 621 
ugcaugauuu auagaguaa 19 
 
 
<210> 622 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 622 
uuacucuaua aaucaugca 19 
 
 
<210> 623 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 623 
cuuuggccga cuucacugu 19 
 
 
<210> 624 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 624 
acagugaagu cggccaaag 19 
 
 
<210> 625 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 625 
auccaccuga aaauauuga 19 
 
 
<210> 626 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 626 
ucaauauuuu cagguggau 19 
 
 
<210> 627 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 627 
uguaauguuc acucucacu 19 
 
 
<210> 628 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 628 
agugagagug aacauuaca 19 
 
 
<210> 629 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 629 
caccugaaaa uauugauga 19 
 
 
<210> 630 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 630 
ucaucaauau uuucaggug 19 
 
 
<210> 631 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 631 
gacuucacug uacaaccgc 19 
 
 
<210> 632 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 632 
gcgguuguac agugaaguc 19 
 
 
<210> 633 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 633 
uaacagaaua cccgaggcu 19 
 
 
<210> 634 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 634 
agccucgggu auucuguua 19 
 
 
<210> 635 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 635 
aguaagagga cuggcugug 19 
 
 
<210> 636 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 636 
cacagccagu ccucuuacu 19 
 
 
<210> 637 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 637 
aaccgcagua auacggaau 19 
 
 
<210> 638 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 638 
auuccguauu acugcgguu 19 
 
 
<210> 639 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 639 
ugucuacccu cuccuguaa 19 
 
 
<210> 640 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 640 
uuacaggaga ggguagaca 19 
 
 
<210> 641 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 641 
gacaacuuug gccgacuuc 19 
 
 
<210> 642 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 642 
gaagucggcc aaaguuguc 19 
 
 
<210> 643 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 643 
gaauacccga ggcugcaug 19 
 
 
<210> 644 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 644 
caugcagccu cggguauuc 19 
 
 
<210> 645 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 645 
acuuacauca aaguuaggu 19 
 
 
<210> 646 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 646 
accuaacuuu gauguaagu 19 
 
 
<210> 647 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 647 
gauuagcaca caugcgccu 19 
 
 
<210> 648 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 648 
aggcgcaugu gugcuaauc 19 
 
 
<210> 649 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<400> 649 
uuacaucaaa guuaggugg 19 
 
 
<210> 650 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<400> 650 
ccaccuaacu uugauguaa 19 
 
 
<210> 651 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 11, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 8, 9, 10, 12, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 651 
uguucgagga uaugacugat t 21 
 
 
<210> 652 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 652 
ucagucauau ccucgaacat t 21 
 
 
<210> 653 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 10, 13, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 9, 11, 12, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 653 
uucacuguac aaccgcagut t 21 
 
 
<210> 654 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 654 
acugcgguug uacagugaat t 21 
 
 
<210> 655 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 8, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 655 
ucucuucguu gacaaaagat t 21 
 
 
<210> 656 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 656 
ucuuuuguca acgaagagat t 21 
 
 
<210> 657 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 657 
uaguaaaaug ucuacccuct t 21 
 
 
<210> 658 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 658 
gaggguagac auuuuacuat t 21 
 
 
<210> 659 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 9, 10, 11, 12, 13, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 659 
ucagaagacu cuugcgucat t 21 
 
 
<210> 660 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 660 
ugacgcaaga gucuucugat t 21 
 
 
<210> 661 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 10, 11, 13, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 7, 12, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 661 
cgcuuuacuu uauaccugat t 21 
 
 
<210> 662 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 662 
ucagguauaa aguaaagcgt t 21 
 
 
<210> 663 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 8, 11, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 9, 10, 12, 13, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 663 
accagacuga uaauauacat t 21 
 
 
<210> 664 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 664 
uguauauuau cagucuggut t 21 
 
 
<210> 665 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 9, 10, 11, 13, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 12, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 665 
aaagacagcc uguguucgat t 21 
 
 
<210> 666 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 666 
ucgaacacag gcugucuuut t 21 
 
 
<210> 667 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 11, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 667 
cugugaagga uaguaaaaut t 21 
 
 
<210> 668 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 668 
auuuuacuau ccuucacagt t 21 
 
 
<210> 669 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 669 
uuuauugaca acacgcuuut t 21 
 
 
<210> 670 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 670 
aaagcguguu gucaauaaat t 21 
 
 
<210> 671 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 12, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 8, 9, 10, 11, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 671 
ccauaacaga auacccgagt t 21 
 
 
<210> 672 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 672 
cucggguauu cuguuauggt t 21 
 
 
<210> 673 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 10, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 673 
ucaaggaaau gauguuuaut t 21 
 
 
<210> 674 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 674 
auaaacauca uuuccuugat t 21 
 
 
<210> 675 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 12, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 9, 11, 13, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 675 
acuucacugu acaaccgcat t 21 
 
 
<210> 676 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 676 
ugcgguugua cagugaagut t 21 
 
 
<210> 677 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 11, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 9, 10, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 677 
accgcaguaa uacggaauat t 21 
 
 
<210> 678 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 8, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 678 
uauuccguau uacugcggut t 21 
 
 
<210> 679 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 12, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 679 
aaagugaucu cauauucuut t 21 
 
 
<210> 680 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 680 
aagaauauga gaucacuuut t 21 
 
 
<210> 681 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 11, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 681 
aggaagauga ugcuuucaat t 21 
 
 
<210> 682 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 682 
uugaaagcau caucuuccut t 21 
 
 
<210> 683 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 11, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 683 
caaagaaagc cgccucaaat t 21 
 
 
<210> 684 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 684 
uuugaggcgg cuuucuuugt t 21 
 
 
<210> 685 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 8, 10, 11, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 9, 12, 13, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 685 
ugauguuuau ugacaacact t 21 
 
 
<210> 686 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 11, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 686 
guguugucaa uaaacaucat t 21 
 
 
<210> 687 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 687 
uguucacucu cacuaacuut t 21 
 
 
<210> 688 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 688 
aaguuaguga gagugaacat t 21 
 
 
<210> 689 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 689 
ggacaaagaa agccgccuct t 21 
 
 
<210> 690 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 690 
gaggcggcuu ucuuugucct t 21 
 
 
<210> 691 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 10, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 8, 9, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 691 
caaccgcagu aauacggaat t 21 
 
 
<210> 692 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 692 
uuccguauua cugcgguugt t 21 
 
 
<210> 693 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 9, 11, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 10, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 693 
aagaaagccg ccucaaacct t 21 
 
 
<210> 694 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 694 
gguuugaggc ggcuuucuut t 21 
 
 
<210> 695 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 8, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 695 
aucucauauu cuuucagaat t 21 
 
 
<210> 696 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 696 
uucugaaaga auaugagaut t 21 
 
 
<210> 697 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 10, 12, 13, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 11, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 697 
auaacagaau acccgaggct t 21 
 
 
<210> 698 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 698 
gccucgggua uucuguuaut t 21 
 
 
<210> 699 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 8, 9, 10, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 699 
gccuguguuc gaggauaugt t 21 
 
 
<210> 700 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 700 
cauauccucg aacacaggct t 21 
 
 
<210> 701 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 8, 11, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 9, 10, 12, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 701 
uuauugacaa cacgcuuuat t 21 
 
 
<210> 702 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 702 
uaaagcgugu ugucaauaat t 21 
 
 
<210> 703 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10, 11, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 703 
acucucacua acuuacauct t 21 
 
 
<210> 704 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 704 
gauguaaguu agugagagut t 21 
 
 
<210> 705 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 9, 10, 11, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 8, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 705 
cugcaugauu uauagaguat t 21 
 
 
<210> 706 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 8, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 706 
uacucuauaa aucaugcagt t 21 
 
 
<210> 707 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 10, 12, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 8, 9, 11, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 707 
ccgcaguaau acggaauaut t 21 
 
 
<210> 708 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 708 
auauuccgua uuacugcggt t 21 
 
 
<210> 709 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 9, 10, 11, 13, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 12, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 709 
acaugcgccu ugugaugact t 21 
 
 
<210> 710 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 710 
gucaucacaa ggcgcaugut t 21 
 
 
<210> 711 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 9, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 7, 8, 10, 11, 12, 13, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 711 
uuccauaaca gaauacccgt t 21 
 
 
<210> 712 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 712 
cggguauucu guuauggaat t 21 
 
 
<210> 713 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 9, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 10, 11, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 713 
auacaaagug aucucauaut t 21 
 
 
<210> 714 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 714 
auaugagauc acuuuguaut t 21 
 
 
<210> 715 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 8, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 13, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 715 
cagaagacuc uugcgucaat t 21 
 
 
<210> 716 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 716 
uugacgcaag agucuucugt t 21 
 
 
<210> 717 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 12, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 717 
uuccagaaag augauuagct t 21 
 
 
<210> 718 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 718 
gcuaaucauc uuucuggaat t 21 
 
 
<210> 719 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 10, 12, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 8, 9, 11, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 719 
uaugacugau auugaucaat t 21 
 
 
<210> 720 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 9, 12, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 720 
uugaucaaua ucagucauat t 21 
 
 
<210> 721 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 8, 11, 12, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 9, 10, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 721 
ggcugcauga uuuauagagt t 21 
 
 
<210> 722 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 722 
cucuauaaau caugcagcct t 21 
 
 
<210> 723 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 8, 10, 11, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 9, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 723 
ccgacuucac uguacaacct t 21 
 
 
<210> 724 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 724 
gguuguacag ugaagucggt t 21 
 
 
<210> 725 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 11, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 725 
auaguaaaau gucuacccut t 21 
 
 
<210> 726 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 726 
aggguagaca uuuuacuaut t 21 
 
 
<210> 727 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 8, 10, 11, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 9, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 727 
ugacugauau ugaucaaagt t 21 
 
 
<210> 728 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 11, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 728 
cuuugaucaa uaucagucat t 21 
 
 
<210> 729 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 8, 11, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 9, 10, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 729 
cuugugauga ccucgccugt t 21 
 
 
<210> 730 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 11, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 730 
caggcgaggu caucacaagt t 21 
 
 
<210> 731 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 10, 13, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 9, 11, 12, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 731 
ucgaggauau gacugauaut t 21 
 
 
<210> 732 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 9, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 732 
auaucaguca uauccucgat t 21 
 
 
<210> 733 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 11, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 10, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 733 
gaugaccucg ccuguauuut t 21 
 
 
<210> 734 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 734 
aaauacaggc gaggucauct t 21 
 
 
<210> 735 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 12, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 735 
agaguaaaca cguuuauuut t 21 
 
 
<210> 736 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 736 
aaauaaacgu guuuacucut t 21 
 
 
<210> 737 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 8, 10, 11, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 737 
ccucucugug aaggauagut t 21 
 
 
<210> 738 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 10, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 738 
acuauccuuc acagagaggt t 21 
 
 
<210> 739 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 8, 9, 11, 12, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 10, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 739 
augauguuua uugacaacat t 21 
 
 
<210> 740 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 10, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 740 
uguugucaau aaacaucaut t 21 
 
 
<210> 741 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 8, 9, 10, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 741 
agacaacuuu ggccgacuut t 21 
 
 
<210> 742 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 742 
aagucggcca aaguugucut t 21 
 
 
<210> 743 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 8, 13, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 9, 10, 11, 12, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 743 
uccauaacag aauacccgat t 21 
 
 
<210> 744 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 744 
ucggguauuc uguuauggat t 21 
 
 
<210> 745 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 8, 10, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 9, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 745 
guacaaccgc aguaauacgt t 21 
 
 
<210> 746 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 746 
cguauuacug cgguuguact t 21 
 
 
<210> 747 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 8, 10, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 9, 11, 13, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 747 
ugauuagcac acaugcgcct t 21 
 
 
<210> 748 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 748 
ggcgcaugug ugcuaaucat t 21 
 
 
<210> 749 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 9, 11, 13, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 10, 12, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 749 
augauuagca cacaugcgct t 21 
 
 
<210> 750 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 750 
gcgcaugugu gcuaaucaut t 21 
 
 
<210> 751 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 12, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 11, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 751 
gcuuuacuuu auaccugaat t 21 
 
 
<210> 752 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 9, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 752 
uucagguaua aaguaaagct t 21 
 
 
<210> 753 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 8, 9, 10, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 7, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 753 
ugcaugauuu auagaguaat t 21 
 
 
<210> 754 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 9, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 754 
uuacucuaua aaucaugcat t 21 
 
 
<210> 755 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 8, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 9, 10, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 755 
cuuuggccga cuucacugut t 21 
 
 
<210> 756 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 756 
acagugaagu cggccaaagt t 21 
 
 
<210> 757 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 9, 10, 11, 12, 13, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 757 
auccaccuga aaauauugat t 21 
 
 
<210> 758 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 758 
ucaauauuuu cagguggaut t 21 
 
 
<210> 759 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 11, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 759 
uguaauguuc acucucacut t 21 
 
 
<210> 760 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 760 
agugagagug aacauuacat t 21 
 
 
<210> 761 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 11, 13, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 8, 9, 10, 12, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 761 
caccugaaaa uauugaugat t 21 
 
 
<210> 762 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 762 
ucaucaauau uuucaggugt t 21 
 
 
<210> 763 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 8, 9, 11, 13, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 10, 12, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 763 
gacuucacug uacaaccgct t 21 
 
 
<210> 764 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 764 
gcgguuguac agugaaguct t 21 
 
 
<210> 765 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 11, 12, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 765 
uaacagaaua cccgaggcut t 21 
 
 
<210> 766 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 766 
agccucgggu auucuguuat t 21 
 
 
<210> 767 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 11, 12, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 13, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 767 
aguaagagga cuggcugugt t 21 
 
 
<210> 768 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 768 
cacagccagu ccucuuacut t 21 
 
 
<210> 769 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 12, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 10, 11, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 769 
aaccgcagua auacggaaut t 21 
 
 
<210> 770 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 770 
auuccguauu acugcgguut t 21 
 
 
<210> 771 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 771 
ugucuacccu cuccuguaat t 21 
 
 
<210> 772 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 772 
uuacaggaga ggguagacat t 21 
 
 
<210> 773 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 10, 11, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 773 
gacaacuuug gccgacuuct t 21 
 
 
<210> 774 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 774 
gaagucggcc aaaguuguct t 21 
 
 
<210> 775 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 8, 13, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 9, 10, 11, 12, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 775 
gaauacccga ggcugcaugt t 21 
 
 
<210> 776 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 776 
caugcagccu cggguauuct t 21 
 
 
<210> 777 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 8, 9, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 10, 11, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 777 
acuuacauca aaguuaggut t 21 
 
 
<210> 778 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 778 
accuaacuuu gauguaagut t 21 
 
 
<210> 779 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 9, 11, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 8, 10, 12, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 779 
gauuagcaca caugcgccut t 21 
 
 
<210> 780 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 780 
aggcgcaugu gugcuaauct t 21 
 
 
<210> 781 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 12, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 9, 10, 11, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 781 
uuacaucaaa guuagguggt t 21 
 
 
<210> 782 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 782 
ccaccuaacu uugauguaat t 21 
 
 
<210> 783 
<211> 1145 
<212> DNA 
<213> Homo sapiens 
  
<220>   
<223> cDNA of human IL-18 

<300>
<308> NM_001562.2
<309> 2009-12-13
  
<400> 783 
attctctccccagcttgctgagccctttgctcccctggcgactgcctggacagtcagcaa 60 
ggaattgtctcccagtgcattttgccctcctggctgccaactctggctgctaaagcggct 120 
gccacctgctgcagtctacacagcttcgggaagaggaaaggaacctcagaccttccagat 180 
cgcttcctctcgcaacaaactatttgtcgcaggaataaagatggctgctgaaccagtaga 240 
agacaattgcatcaactttgtggcaatgaaatttattgacaatacgctttactttatagc 300 
tgaagatgatgaaaacctggaatcagattactttggcaagcttgaatctaaattatcagt 360 
cataagaaatttgaatgaccaagttctcttcattgaccaaggaaatcggcctctatttga 420 
agatatgactgattctgactgtagagataatgcaccccggaccatatttattataagtat 480 
gtataaagatagccagcctagaggtatggctgtaactatctctgtgaagtgtgagaaaat 540 
ttcaactctctcctgtgagaacaaaattatttcctttaaggaaatgaatcctcctgataa 600 
catcaaggatacaaaaagtgacatcatattctttcagagaagtgtcccaggacatgataa 660 
taagatgcaatttgaatcttcatcatacgaaggatactttctagcttgtgaaaaagagag 720 
agacctttttaaactcattttgaaaaaagaggatgaattgggggatagatctataatgtt 780 
cactgttcaaaacgaagactagctattaaaatttcatgccgggcgcagtggctcacgcct 840 
gtaatcccagccctttgggaggctgaggcgggcagatcaccagaggtcaggtgttcaaga 900 
ccagcctgaccaacatggtgaaacctcatctctactaaaaatacaaaaaattagctgagt 960 
gtagtgacgcatgccctcaatcccagctactcaagaggctgaggcaggagaatcacttgc 1020 
actccggaggtagaggttgtggtgagccgagattgcaccattgcgctctagcctgggcaa 1080 
caacagcaaaactccatctcaaaaaataaaataaataaataaacaaataaaaaattcata 1140 
atgtg                                                              1145 
 
 

<210> 784 
<211> 1165 
<212> DNA 
<213> Macaca fascicularis 
  
<220>   
<223> cDNA of cynomolgous monkey IL-18 
  
<220>   
<221> modified_base 
<222> 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 855, 956, 977, 978, 987, 1070, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165 
<223> /mod_base = "unknown nucleotide" 
  
<400> 784 
attctctcccgagcctgctgagccctttgctcccctggcgactgcctggacaggcagcaa 60 
ggagttgtctcccagtgcgttttgccctcctagctgccaactctggctgctaaagcggct 120 
gccacctgctacagtctgttacacagcctcgggaagaggaaagggacctcggaccttcca 180 
gattgctttctctagcaagaaacnnnnnnnnnnnnnnnnnnnnatggctgctgaaccagc 240 
agaagacaattgcatcaattttgtggcaatgaaatttattgacagtacgctttactttat 300 
agctgaagatgatgaaaacctggaatcagattactttggcaagcttgaatctaaattatc 360 
aatcataagaaatttgaatgaccaagttctcttcattgaccaaggaaatcggcccctatt 420 
tgaagatatgactgattctgactgtagagataatgcaccccggaccatatttattataaa 480 
tatgtataaagatagccagcctagaggtatggctgtagccatctctgtgaaatgtgagaa 540 
aatttcaactctctcctgtgagaacagaattatttcctttaaggaaatgaatcctcctga 600 
taacatcaaggatacgaaaagtgacatcatattctttcagagaagtgtcccaggacatga 660 
taataagatgcaatttgaatcttcatcatacgaaggatactttctagcttgtgaaaaaga 720 
gagagacctttataaactcattttgaaaaaaaaggatgaattgggggatagatctataat 780 
gttcactgttcaaaacgaagactagctattaaaatttcatgcygggcrcrgtggctcamg 840 
cctgtaatcccagcnactttgggaggcygagrygggygsrkmwcmygagkkswsrrgagt 900 
tcaagaccwgcctgrccaacatrrtgaaaccysgtctctaytaaaaatacaaaaanttag 960 
ctgggcgtggtggtggnntcgcctatnaatcccagctacttgggaggctgaggcagraga 1020 
atyacattrmrctccgagaggcagaggttgtggtgagccgagatcatgcncactgcactc 1080 
cagcctgggyracarcagcragactyyrtctynnnnnnnnnnnnnnnnnnnnnnnnnnnn 1140 
nnnnnnnnnnnnnnnnnnnnnnnnn                                        1165 
 
 
<210> 785 
<211> 865 
<212> DNA 
<213> Mus musculus 

<220>   
<223> cDNA of mouse IL-18 

<300>
<308> NM_008360.1 
<309> 2009-12-13
  
<400> 785 
ggcacagctggacctggtgggggttctctgtggttccatgctttctggactcctgcctgc 60 
tggctggagctgctgacaggcctgacatcttctgcaacctccagcatcaggacaaagaaa 120 
gccgcctcaaaccttccaaatcacttcctcttggcccaggaacaatggctgccatgtcag 180 
aagactcttgcgtcaacttcaaggaaatgatgtttattgacaacacgctttactttatac 240 
ctgaagaaaatggagacctggaatcagacaactttggccgacttcactgtacaaccgcag 300 
taatacggaatataaatgaccaagttctcttcgttgacaaaagacagcctgtgttcgagg 360 
atatgactgatattgatcaaagtgccagtgaaccccagaccagactgataatatacatgt 420 
acaaagacagtgaagtaagaggactggctgtgaccctctctgtgaaggatagtaaaatgt 480 
ctaccctctcctgtaagaacaagatcatttcctttgaggaaatggatccacctgaaaata 540 
ttgatgatatacaaagtgatctcatattctttcagaaacgtgttccaggacacaacaaga 600 
tggagtttgaatcttcactgtatgaaggacactttcttgcttgccaaaaggaagatgatg 660 
ctttcaaactcattctgaaaaaaaaggatgaaaatggggataaatctgtaatgttcactc 720 
tcactaacttacatcaaagttaggtggggagggtttgtgttccagaaagatgattagcac 780 
acatgcgccttgtgatgacctcgcctgtatttccataacagaatacccgaggctgcatga 840 
tttatagagtaaacacgtttatttg                                        865 
 



<210> 786 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 786 
ccgctttagc agccagagtt gtttttctct tggaaagaaa gt 42 
 
 
<210> 787 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 787 
tagactgcag caggtggcag tttttctctt ggaaagaaag t 41 
 
 
<210> 788 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 788 
gatctggaag gtctgaggtt ccttttttct cttggaaaga aagt 44 
 
 
<210> 789 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 789 
aatagtttgt tgcgagagga agctttttct cttggaaaga aagt 44 
 
 
<210> 790 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 790 
acaggagaga gttgaaattt tctcattttt ctcttggaaa gaaagt 46 
 
 
<210> 791 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 791 
tccttaaagg aaataatttt gttctctttt tctcttggaa agaaagt 47 
 
 
<210> 792 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 792 
gctgactgtc caggcagtcg tttttaggca taggacccgt gtct 44 
 
 
<210> 793 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 793 
tgcactggga gacaattcct ttttttaggc ataggacccg tgtct 45 
 
 
<210> 794 
<211> 48 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 794 
caattgtctt ctactggttc agcattttta ggcataggac ccgtgtct 48 
 
 
<210> 795 
<211> 48 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 795 
gattccaggt tttcatcatc ttcattttta ggcataggac ccgtgtct 48 
 
 
<210> 796 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 796 
atcttcaaat agaggccgat ttctttttag gcataggacc cgtgtct 47 
 
 
<210> 797 
<211> 51 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 797 
cacttcacag agatagttac agccatattt ttaggcatag gacccgtgtc t 51 
 
 
<210> 798 
<211> 49 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 798 
cttgatgtta tcaggaggat tcattttttt aggcatagga cccgtgtct 49 
 
 
<210> 799 
<211> 18 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 799 
gcagccagga gggcaaaa 18 
 
 
<210> 800 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 800 
ttcctcttcc cgaagctgtg  20 
 
 
<210> 801 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 801 
gccatcttta ttcctgcgac a 21 
 
 
<210> 802 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 802 
atttcattgc cacaaagttg atg 23 
 
 
<210> 803 
<211> 28 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 803 
gctataaagt aaagcgtatt gtcaataa 28 
 
 
<210> 804 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 804 
gattcaagct tgccaaagta atct 24 
 
 
<210> 805 
<211> 29 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 805 
cattcaaatt tcttatgact gataattta 29 
 
 
<210> 806 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 806 
cttggtcaat gaagagaact tggt 24 
 
 
<210> 807 
<211> 29 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 807 
gcattatctc tacagtcaga atcagtcat 29 
 
 
<210> 808 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 808 
cttataataa atatggtccg gggt 24 
 
 
<210> 809 
<211> 27 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 809 
cctctaggct ggctatcttt atacata 27 
 
 
<210> 810 
<211> 28 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 810 
gaaagaatat gatgtcactt tttgtatc 28 
 
 
<210> 811 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 811 
gaatttgcca tgggtggaat tttttctctt ggaaagaaag t 41 
 
 
<210> 812 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 812 
ggagggatct cgctcctgga tttttctctt ggaaagaaag t 41 
 
 
<210> 813 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 813 
ccccagcctt ctccatggtt ttttctcttg gaaagaaagt  40 
 
 
<210> 814 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 814 
gctcccccct gcaaatgagt ttttctcttg gaaagaaagt  40 
 
 
<210> 815 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 815 
agccttgacg gtgccatgtt tttaggcata ggacccgtgt ct 42 
 
 
<210> 816 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 816 
gatgacaagc ttcccgttct ctttttaggc ataggacccg tgtct 45 
 
 
<210> 817 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 817 
agatggtgat gggatttcca tttttttagg cataggaccc gtgtct 46 
 
 
<210> 818 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 818 
gcatcgcccc acttgatttt tttttaggca taggacccgt gtct 44 
 
 
<210> 819 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 819 
cacgacgtac tcagcgccat ttttaggcat aggacccgtg tct 43 
 
 
<210> 820 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 820 
ggcagagatg atgacccttt tgtttttagg cataggaccc gtgtct 46 
 
 
<210> 821 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH  
  
<400> 821 
ggtgaagacg ccagtggact c 21 
 
 
<210> 822 
<211> 38 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 822 
ccagccagca ggcaggattt ttctcttgga aagaaagt 38 
 
 
<210> 823 
<211> 39 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 823 
tgtcaggcct gtcagcagct tttttgaagt taccgtttt 39 
 
 
<210> 824 
<211> 40 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 824 
gatgctggag gttgcagaag atttttctga gtcaaagcat  40 
 
 
<210> 825 
<211> 41 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 825 
gaggcggctt tctttgtcct tttttctctt ggaaagaaag t 41 
 
 
<210> 826 
<211> 45 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 826 
aagaggaagt gatttggaag gttttttttc tcttggaaag aaagt 45 
 
 
<210> 827 
<211> 39 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 827 
agccattgtt cctgggcctt tttctcttgg aaagaaagt 39 
 
 
<210> 828 
<211> 41 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 828 
cgcaagagtc ttctgacatg gctttttgaa gttaccgttt t 41 
 
 
<210> 829 
<211> 45 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 829 
aataaacatc atttccttga agttgatttt tctgagtcaa agcat 45 
 
 
<210> 830 
<211> 45 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 830 
tcaggtataa agtaaagcgt gttgtctttt tgaagttacc gtttt 45 
 
 
<210> 831 
<211> 42 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 831 
ctgattccag gtctccattt tcttttttct gagtcaaagc at 42 
 
 
<210> 832 
<211> 22 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 832 
cagtgaagtc ggccaaagtt gt 22 
 
 
<210> 833 
<211> 43 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 833 
atattccgta ttactgcggt tgtatttttg aagttaccgt ttt 43 
 
 
<210> 834 
<211> 43 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 834 
tcaacgaaga gaacttggtc attttttttc tgagtcaaag cat 43 
 
 
<210> 835 
<211> 43 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 835 
ctcgaacaca ggctgtcttt tgtttttctc ttggaaagaa agt 43 
 
 
<210> 836 
<211> 46 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 836 
ggcactttga tcaatatcag tcatatcttt ttgaagttac cgtttt 46 
 
 
<210> 837 
<211> 41 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 837 
tcagtctggt ctggggttca cttttttctg agtcaaagca t 41 
 
 
<210> 838 
<211> 31 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 838 
cttacttcac tgtctttgta catgtatatt a 31 
 
 
<210> 839 
<211> 40 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 839 
gagagggtca cagccagtcc ttttttgaag ttaccgtttt  40 
 
 
<210> 840 
<211> 45 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 840 
gggtagacat tttactatcc ttcacatttt tctgagtcaa agcat 45 
 
 
<210> 841 
<211> 47 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse IL-18 
  
<400> 841 
ggaaatgatc ttgttcttac aggagatttt tctcttggaa agaaagt 47 
 
 
<210> 842 
<211> 40 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 842 
cgaggctggc actgcacaat ttttctcttg gaaagaaagt  40 
 
 
<210> 843 
<211> 41 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 843 
cttcaccatt ttgtctacgg gatttttgaa gttaccgttt t 41 
 
 
<210> 844 
<211> 39 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 844 
ccaaatccgt tcacaccgac tttttctgag tcaaagcat 39 
 
 
<210> 845 
<211> 38 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 845 
ccaggcgccc aatacggttt ttctcttgga aagaaagt 38 
 
 
<210> 846 
<211> 38 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 846 
caaatggcag ccctggtgat ttttgaagtt accgtttt 38 
 
 
<210> 847 
<211> 41 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 847 
aacaatctcc actttgccac tgtttttctg agtcaaagca t 41 
 
 
<210> 848 
<211> 19 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 848 
tgaaggggtc gttgatggc 19 
 
 
<210> 849 
<211> 26 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 849 
catgtagacc atgtagttga ggtcaa 26 
 
 
<210> 850 
<211> 44 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 850 
ccgtgagtgg agtcatactg gaatttttct cttggaaaga aagt 44 
 
 
<210> 851 
<211> 42 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 851 
ttgactgtgc cgttgaattt gtttttctct tggaaagaaa gt 42 
 
 
<210> 852 
<211> 37 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 852 
agcttcccat tctcggcctt tttgaagtta ccgtttt 37 
 
 
<210> 853 
<211> 38 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 853 
gggcttcccg ttgatgacat ttttctgagt caaagcat 38 
 
 
<210> 854 
<211> 41 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 854 
cgctcctgga agatggtgat tttttctctt ggaaagaaag t 41 
 
 
<210> 855 
<211> 23 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 855 
cccatttgat gttagtgggg tct 23 
 
 
<210> 856 
<211> 41 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for mouse GAPDH  
  
<400> 856 
atactcagca ccggcctcac tttttctctt ggaaagaaag t 41 
 
 
<210> 857 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 857 
gaaacacuuu gccgcaggct t 21 
 
 
<210> 858 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 858 
gccugcggca aaguguuuct t 21 
 
 
<210> 859 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 859 
gaaauaauuu ggcgcaggct t 21 
 
 
<210> 860 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 860 
gccugcgcca aauuauuuct t 21 
 
 
<210> 861 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 861 
cagacuauuu accgcagggt t 21 
 
 
<210> 862 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 862 
cccugcggua aauagucugt t 21 
 
 
<210> 863 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 863 
gaaacucuuu guggcaggat t 21 
 
 
<210> 864 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 864 
uccugccaca aagaguuuct t 21 
 
 
<210> 865 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 865 
gaaacuuuuu gucacaggut t 21 
 
 
<210> 866 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 866 
accugugaca aaaaguuuct t 21 
 
 
<210> 867 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 867 
aaagcaauuu guugcaggct t 21 
 
 
<210> 868 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 868 
gccugcaaca aauugcuuut t 21 
 
 
<210> 869 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 869 
uaaagaauuu gucacaggat t 21 
 
 
<210> 870 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 870 
uccugugaca aauucuuuat t 21 
 
 
<210> 871 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 871 
uaaucuacuu guugcaggat t 21 
 
 
<210> 872 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 872 
uccugcaaca aguagauuat t 21 
 
 
<210> 873 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 873 
aaaaccauug guugcaggat t 21 
 
 
<210> 874 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 874 
uccugcaacc aaugguuuut t 21 
 
 
<210> 875 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 875 
gaaacuaagu guggcagggt t 21 
 
 
<210> 876 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 876 
cccugccaca cuuaguuuct t 21 
 
 
<210> 877 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 877 
caaaguauuu ggcgcuggct t 21 
 
 
<210> 878 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 878 
gccagcgcca aauacuuugt t 21 
 
 
<210> 879 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 879 
cauacuauuu gacgcagaat t 21 
 
 
<210> 880 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 880 
uucugcguca aauaguaugt t 21 
 
 
<210> 881 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 881 
uccuaaaaca aauaguuuat t 21 
 
 
<210> 882 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 882 
uaaacuauuu guuuuaggat t 21 
 
 
<210> 883 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 883 
uccuguaaca acuaguuuut t 21 
 
 
<210> 884 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 884 
aaaacuaguu guuacaggat t 21 
 
 
<210> 885 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 885 
aaauauaaaa agauagccgt t 21 
 
 
<210> 886 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 886 
cggcuaucuu uuuauauuut t 21 
 
 
<210> 887 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 887 
cuuuuaauaa agauagccat t 21 
 
 
<210> 888 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 888 
uggcuaucuu uauuaaaagt t 21 
 
 
<210> 889 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 889 
auauggaaga agauagccat t 21 
 
 
<210> 890 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 890 
uggcuaucuu cuuccauaut t 21 
 
 
<210> 891 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 891 
auauuucuua agauagccct t 21 
 
 
<210> 892 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 892 
gggcuaucuu aagaaauaut t 21 
 
 
<210> 893 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 893 
ucauguaaca agauagccat t 21 
 
 
<210> 894 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 894 
uggcuaucuu guuacaugat t 21 
 
 
<210> 895 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 895 
auauauauua ugauagccut t 21 
 
 
<210> 896 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 896 
aggcuaucau aauauauaut t 21 
 
 
<210> 897 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 897 
guauuuagaa acauagccct t 21 
 
 
<210> 898 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 898 
gggcuauguu ucuaaauact t 21 
 
 
<210> 899 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 899 
auaugcauaa agauagacut t 21 
 
 
<210> 900 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 900 
agucuaucuu uaugcauaut t 21 
 
 
<210> 901 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 901 
auauguaaaa agauagcact t 21 
 
 
<210> 902 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 902 
gugcuaucuu uuuacauaut t 21 
 
 
<210> 903 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 903 
uuauguauua agauaaccut t 21 
 
 
<210> 904 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 904 
agguuaucuu aauacauaat t 21 
 
 
<210> 905 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 905 
guauguauaa ggauggccat t 21 
 
 
<210> 906 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 906 
uggccauccu uauacauact t 21 
 
 
<210> 907 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 907 
auauguauaa agagagacat t 21 
 
 
<210> 908 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 908 
ugucucucuu uauacauaut t 21 
 
 
<210> 909 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 909 
aggcuauuuu uauacuuaat t 21 
 
 
<210> 910 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 910 
uuaaguauaa aaauagccut t 21 
 
 
<210> 911 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 911 
aggcuaucuc uauacacaat t 21 
 
 
<210> 912 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 912 
uuguguauag agauagccut t 21 
 
 
<210> 913 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 913 
caaaugacau gauaauaaat t 21 
 
 
<210> 914 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 914 
uuuauuauca ugucauuugt t 21 
 
 
<210> 915 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 915 
ccccagccau gauaauaaat t 21 
 
 
<210> 916 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 916 
uuuauuauca uggcuggggt t 21 
 
 
<210> 917 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 917 
cucaugacag gauaauaagt t 21 
 
 
<210> 918 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 918 
cuuauuaucc ugucaugagt t 21 
 
 
<210> 919 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 919 
ucaaggaacu gauaauaagt t 21 
 
 
<210> 920 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 920 
cuuauuauca guuccuugat t 21 
 
 
<210> 921 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 921 
uacaagacau guuaauaagt t 21 
 
 
<210> 922 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 922 
cuuauuaaca ugucuuguat t 21 
 
 
<210> 923 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 923 
cccaggacau uaaaauaagt t 21 
 
 
<210> 924 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 924 
cuuauuuuaa uguccugggt t 21 
 
 
<210> 925 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 925 
uccaggacau gguaauagut t 21 
 
 
<210> 926 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 926 
acuauuacca uguccuggat t 21 
 
 
<210> 927 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 927 
accaggacau gagaauagat t 21 
 
 
<210> 928 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 928 
ucuauucuca uguccuggut t 21 
 
 
<210> 929 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 929 
accaggacau gauuauagct t 21 
 
 
<210> 930 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 930 
gcuauaauca uguccuggut t 21 
 
 
<210> 931 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 931 
cccaggacau gaaaaaaaut t 21 
 
 
<210> 932 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 932 
auuuuuuuca uguccugggt t 21 
 
 
<210> 933 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 933 
gccaggacau gaucaugact t 21 
 
 
<210> 934 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 934 
gucaugauca uguccuggct t 21 
 
 
<210> 935 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 935 
uccaggacau gauacugaut t 21 
 
 
<210> 936 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 936 
aucaguauca uguccuggat t 21 
 
 
<210> 937 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 937 
auuauuaaca uguccugggt t 21 
 
 
<210> 938 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 938 
cccaggacau guuaauaaut t 21 
 
 
<210> 939 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 939 
cuuguuguca uguccuggut t 21 
 
 
<210> 940 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 940 
accaggacau gacaacaagt t 21 
 
 

<210> 941 
<211> 18 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 941 
gcgcagtcgg ggcagtat 18 
 
 
<210> 942 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 942 
ccacgatgaa gaagggcact  20 
 
 
<210> 943 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 943 
gggtcaggac tccaagcaga tttttctctt ggaaagaaag t 41 
 
 
<210> 944 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 944 
cccattgtcc agctctccct tttttctctt ggaaagaaag t 41 
 
 
<210> 945 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 945 
gccaggtcga tgaaggtgat tttttctctt ggaaagaaag t 41 
 
 
<210> 946 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 946 
ggcactgacg aggagcaggt ttttctcttg gaaagaaagt  40 
 
 
<210> 947 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 947 
gtgccagcaa tcccagtgtt tttttctctt ggaaagaaag t 41 
 
 
<210> 948 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 948 
gcacataggt cgatcttgct gatttttctc ttggaaagaa agt 43 
 
 
<210> 949 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 949 
agccaggctg cttgaggact ttttctcttg gaaagaaagt  40 
 
 
<210> 950 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 950 
tgctgggcag cagtgacgtt tttctcttgg aaagaaagt 39 
 
 
<210> 951 
<211> 36 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 951 
ccccaggacg gccacacttt ttgaagttac cgtttt 36 
 
 
<210> 952 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 952 
gttgacttcc cagagtccac atttttttct gagtcaaagc at 42 
 
 
<210> 953 
<211> 33 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 953 
cgagcccggc cccgtttttg aagttaccgt ttt 33 
 
 
<210> 954 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 954 
gtggcggaaa aggttgagct ttttctgagt caaagcat 38 
 
 
<210> 955 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 955 
ggccagactg aatctcatgc agtttttgaa gttaccgttt t 41 
 
 
<210> 956 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 956 
cgaagctgat gctggaggtt ctttttctga gtcaaagcat  40 
 
 
<210> 957 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 957 
tgctgttaaa gcccaggatc ttttttgaag ttaccgtttt  40 
 
 
<210> 958 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 958 
gctgtaattc accacctctc ccttttttct gagtcaaagc at 42 
 
 
<210> 959 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 959 
tctcttctgc tgtccgtgag tctttttgaa gttaccgttt t 41 
 
 
<210> 960 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 960 
catcttggag ctgctctcac agatttttct gagtcaaagc at 42 
 
 
<210> 961 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 961 
gtgtgtaggt acttatggtg gccttttttg aagttaccgt ttt 43 
 
 
<210> 962 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 962 
gatgtgaggc caaagatggt gtttttctga gtcaaagcat  40 
 
 
<210> 963 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 963 
gccccagatg ttcccttgtg tttttgaagt taccgtttt 39 
 
 
<210> 964 
<211> 35 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 964 
ttcagggcca gggccatttt tctgagtcaa agcat 35 
 
 
<210> 965 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 965 
tgtcctctcc actgtggtct tgtttttgaa gttaccgttt t 41 
 
 
<210> 966 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 966 
ccgctccagc tggcgtactt tttctgagtc aaagcat 37 
 
 
<210> 967 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 967 
gcatggggac cttgtggctt tttgaagtta ccgtttt 37 
 
 
<210> 968 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GTPBP2 
  
<400> 968 
gcatcatcct cagaggtgac catttttctg agtcaaagca t 41 
 
 

<210> 969 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 969 
tggtcctcgc tcttgtcctc t 21 
 
 
<210> 970 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 970 
tgcaccagga ccttgtcact t 21 
 
 
<210> 971 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 971 
acttgcttgc actcttgcag tagtttttct cttggaaaga aagt 44 
 
 
<210> 972 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 972 
ggagtaaagc tctgcagcgc tttttctctt ggaaagaaag t 41 
 
 
<210> 973 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 973 
ttgtcctctg ggcccacgtt tttctcttgg aaagaaagt 39 
 
 
<210> 974 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 974 
gccgcagccg cacagttttt tctcttggaa agaaagt 37 
 
 
<210> 975 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 975 
acctgcagaa gttttccaga gactttttct cttggaaaga aagt 44 
 
 
<210> 976 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 976 
ccacctgcgg ggcaattttt ttctcttgga aagaaagt 38 
 
 
<210> 977 
<211> 48 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 977 
actgctcaga atatactctg cttttaattt ttctcttgga aagaaagt 48 
 
 
<210> 978 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 978 
ccctctgatc tgtatacaga ccgacttttt ctcttggaaa gaaagt 46 
 
 
<210> 979 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 979 
tccaacaaga gctgatccag ctttttgaag ttaccgtttt  40 
 
 
<210> 980 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 980 
tccgacacat ctggcgcttt tttctgagtc aaagcat 37 
 
 
<210> 981 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 981 
cagggtcctt aactcgctgg tttttgaagt taccgtttt 39 
 
 
<210> 982 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 982 
catttccttt gcctcctgga ttttttctga gtcaaagcat  40 
 
 
<210> 983 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 983 
aggcacgaag ggccactttt tttgaagtta ccgtttt 37 
 
 
<210> 984 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 984 
gcttgtttgt actgccactt ttctttttct gagtcaaagc at 42 
 
 
<210> 985 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 985 
ccaatcacat ccttcaggtt tgtttttttg aagttaccgt ttt 43 
 
 
<210> 986 
<211> 34 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 986 
tgctgcaacc cggcgttttt ctgagtcaaa gcat 34 
 
 
<210> 987 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 987 
ccctcaggga cgccagtaac tttttgaagt taccgtttt 39 
 
 
<210> 988 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 988 
cccgagcgag gatggaggtt tttctgagtc aaagcat 37 
 
 
<210> 989 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 989 
ggtccaccaa gaacacaata gcctttttga agttaccgtt tt 42 
 
 
<210> 990 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 990 
gtcgagccca tacaggaacc tttttctgag tcaaagcat 39 
 
 
<210> 991 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 991 
acttgtggag acctttggcg tttttgaagt taccgtttt 39 
 
 
<210> 992 
<211> 35 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 992 
ggcgtggctg gctgcatttt tctgagtcaa agcat 35 
 
 
<210> 993 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 993 
ttcgggcttg gcgaataatt tttgaagtta ccgtttt 37 
 
 
<210> 994 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 994 
aagttttcct gagttcacgg agatttttct gagtcaaagc at 42 
 
 
<210> 995 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 995 
cgttgctcca ttgttgctta ttagtttttg aagttaccgt ttt 43 
 
 
<210> 996 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ALPK1 
  
<400> 996 
tcatttctgt acagccaggt acctttttct gagtcaaagc at 42 
 
 

<210> 997 
<211> 31 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 997 
tcttttttct agtagtattc gaaatagatt a 31 
 
 
<210> 998 
<211> 25 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 998 
gagagaagaa gttatgtggc taagg 25 
 
 
<210> 999 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 999 
tttggctttt tatatcagaa gaaatttttt tctcttggaa agaaagt 47 
 
 
<210> 1000 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1000 
tgcttgaaga ggcaatttgc ttttttctct tggaaagaaa gt 42 
 
 
<210> 1001 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1001 
gcagagagca gtgtcaaacg atgtttttct cttggaaaga aagt 44 
 
 
<210> 1002 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1002 
tcttgcatga gtcttcgatc catttttctc ttggaaagaa agt 43 
 
 
<210> 1003 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1003 
tttcttcttc cgtattaaca gcactttttt ctcttggaaa gaaagt 46 
 
 
<210> 1004 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1004 
agagaaggat aactgaccga cttctttttt ctcttggaaa gaaagt 46 
 
 
<210> 1005 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1005 
agaattcacc ttgcagctca agtttttctc ttggaaagaa agt 43 
 
 
<210> 1006 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1006 
tgcccacctt tgactgtatt gttttttctc ttggaaagaa agt 43 
 
 
<210> 1007 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1007 
cttttcggat gtccacaata ttgtttttga agttaccgtt tt 42 
 
 
<210> 1008 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1008 
ttcattgcaa tctcacggtt atatattttt ctgagtcaaa gcat 44 
 
 
<210> 1009 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1009 
tacccattta ggtcagtata aaatctattt tttgaagtta ccgtttt 47 
 
 
<210> 1010 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1010 
cagtgtcatt ctaggttgaa tctggttttt ctgagtcaaa gcat 44 
 
 
<210> 1011 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1011 
cattgtggtc atgggataga catttttttg aagttaccgt ttt 43 
 
 
<210> 1012 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1012 
tttggcatcc tggatatagg ctttttctga gtcaaagcat  40 
 
 
<210> 1013 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1013 
aactcgaaac ccctaatgac tgatttttga agttaccgtt tt 42 
 
 
<210> 1014 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1014 
tgataacttc aatctgacca ctattcattt ttctgagtca aagcat 46 
 
 
<210> 1015 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1015 
tgctcaaggc cacgattatc atttttgaag ttaccgtttt  40 
 
 
<210> 1016 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1016 
gctgtaatct tgttatcctg gatacctttt ttctgagtca aagcat 46 
 
 
<210> 1017 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1017 
cattggaatg actggatgat tcattttttg aagttaccgt ttt 43 
 
 
<210> 1018 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1018 
ggtaggtgag gagaacttat ttgctttttc tgagtcaaag cat 43 
 
 
<210> 1019 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1019 
aaggcaaaga tgactgtaat ggagtttttg aagttaccgt ttt 43 
 
 
<210> 1020 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1020 
tctcaaatta accagatgaa tgtcactttt tctgagtcaa agcat 45 
 
 
<210> 1021 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1021 
gcctcattgg agtgcccatt ttttgaagtt accgtttt 38 
 
 
<210> 1022 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human MAN2A1 
  
<400> 1022 
ttttctgtgg aggatcaagg cttttttctg agtcaaagca t 41 
 
 

<210> 1023 
<211> 16 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1023 
aggggggccc cacact 16 
 
 
<210> 1024 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1024 
gggactcctt gttgctcagg  20 
 
 
<210> 1025 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1025 
ctcctcactc cctggccctt ttttctcttg gaaagaaagt  40 
 
 
<210> 1026 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1026 
gaagcagggc gtccacttct ttttctcttg gaaagaaagt  40 
 
 
<210> 1027 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1027 
tgaccgttca ttctgggctg tttttctctt ggaaagaaag t 41 
 
 
<210> 1028 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1028 
gcaggcctcg gctggagttt tttctcttgg aaagaaagt 39 
 
 
<210> 1029 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1029 
gggccgaggg ctaagccttt ttctcttgga aagaaagt 38 
 
 
<210> 1030 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1030 
gctgttccgg taaggcacgt tttttctctt ggaaagaaag t 41 
 
 
<210> 1031 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1031 
tctgcagcag gtaggtcagt tttttttctc ttggaaagaa agt 43 
 
 
<210> 1032 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1032 
cactggttca ccttggaggc tttttctctt ggaaagaaag t 41 
 
 
<210> 1033 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1033 
atcgagcatt ggtgacagtg agtttttgaa gttaccgttt t 41 
 
 
<210> 1034 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1034 
tttctcacag gagacaggga cattttttct gagtcaaagc at 42 
 
 
<210> 1035 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1035 
gattctggcg ggccagattt tttgaagtta ccgtttt 37 
 
 
<210> 1036 
<211> 34 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1036 
tgcgggccac agcccttttt ctgagtcaaa gcat 34 
 
 
<210> 1037 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1037 
gaatacactg tggctgcgtg atttttgaag ttaccgtttt  40 
 
 
<210> 1038 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1038 
gctccccaga aatctgtagc tgtttttctg agtcaaagca t 41 
 
 
<210> 1039 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1039 
cggccaggtc cacaagactg tttttgaagt taccgtttt 39 
 
 
<210> 1040 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1040 
ggggtcaagt cgctcactcc tttttctgag tcaaagcat 39 
 
 
<210> 1041 
<211> 34 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1041 
cgttcccgct ccccgttttt gaagttaccg tttt 34 
 
 
<210> 1042 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1042 
ggcctgtgtt tcccgaaggt ttttctgagt caaagcat 38 
 
 
<210> 1043 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1043 
cgtggacagg ctgctgttaa ttttttgaag ttaccgtttt  40 
 
 
<210> 1044 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1044 
gccatgataa ccagccccag tttttctgag tcaaagcat 39 
 
 
<210> 1045 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1045 
tcttagcact accacccaga gagttttttg aagttaccgt ttt 43 
 
 
<210> 1046 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1046 
gagaaatgtt cacaaacatg agcatttttc tgagtcaaag cat 43 
 
 
<210> 1047 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1047 
cggagacgtt ctcttccagt gtttttgaag ttaccgtttt  40 
 
 
<210> 1048 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human KIFC1 
  
<400> 1048 
aaagcgtaga gagttgaggg acttttttct gagtcaaagc at 42 
 
 

<210> 1049 
<211> 19 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1049 
ccccctgcct gatagtccc 19 
 
 
<210> 1050 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1050 
ccctcagagt tccttccccc  20 
 
 
<210> 1051 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1051 
tcccttttca tcattaacct gct 23 
 
 
<210> 1052 
<211> 22 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1052 
cctgagagtc cgccctattc tc 22 
 
 
<210> 1053 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1053 
actttcagag ccttcattct ggttttttct cttggaaaga aagt 44 
 
 
<210> 1054 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1054 
gacctcctgg ggatgcaagt ttttctcttg gaaagaaagt  40 
 
 
<210> 1055 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1055 
tgttcctgtt tttgcttctg ttctttttct cttggaaaga aagt 44 
 
 
<210> 1056 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1056 
ccctctggct ccccagtgat ttttctcttg gaaagaaagt  40 
 
 
<210> 1057 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1057 
ggacctccct gaccctgagc tttttctctt ggaaagaaag t 41 
 
 
<210> 1058 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1058 
ccaaaaaggt ttgactcttt tcgttttttc tcttggaaag aaagt 45 
 
 
<210> 1059 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1059 
cgctgactgg cacccctttt ttttctcttg gaaagaaagt  40 
 
 
<210> 1060 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1060 
gctctttcgc ctcctgcctt tttctcttgg aaagaaagt 39 
 
 
<210> 1061 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1061 
gcagggagaa taatatctgg tctgattttt gaagttaccg tttt 44 
 
 
<210> 1062 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1062 
tggtctctgc aggatgctct tctttttctg agtcaaagca t 41 
 
 
<210> 1063 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1063 
ctcctcaggt ggcagctctt tttttgaagt taccgtttt 39 
 
 
<210> 1064 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1064 
agcccttgac tttcctgcag tttttctgag tcaaagcat 39 
 
 
<210> 1065 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1065 
ccctgctcct ccagaacttg tttttgaagt taccgtttt 39 
 
 
<210> 1066 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1066 
cgaaatcctg cttcctgctg ttttttctga gtcaaagcat  40 
 
 
<210> 1067 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1067 
cccatcggca caaacatcct tttttgaagt taccgtttt 39 
 
 
<210> 1068 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1068 
ctatcatctg ttcctcccct aatagttttt ctgagtcaaa gcat 44 
 
 
<210> 1069 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1069 
cccaagcatc acatcttgta cctttttgaa gttaccgttt t 41 
 
 
<210> 1070 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1070 
gccccattct ttctccttgt cttttttctg agtcaaagca t 41 
 
 
<210> 1071 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1071 
tcccactcac cgtcattcag atttttgaag ttaccgtttt  40 
 
 
<210> 1072 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1072 
cttcctctcc atatcctcct gctttttctg agtcaaagca t 41 
 
 
<210> 1073 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1073 
ctcttcctct cttctccctg ttcttttttg aagttaccgt ttt 43 
 
 
<210> 1074 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1074 
ttctggcacc tgcagctcct ttttctgagt caaagcat 38 
 
 
<210> 1075 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1075 
tttccagtta cttcctctga ttttcttttt gaagttaccg tttt 44 
 
 
<210> 1076 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human ARHGEF5 
  
<400> 1076 
ctcctttata ccatgatctt cttgcttttt ctgagtcaaa gcat 44 
 
 

<210> 1077 
<211> 19 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1077 
ctcctgcacg tgggctctc 19 
 
 
<210> 1078 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1078 
aagtctctgg aggaagcaaa gaa 23 
 
 
<210> 1079 
<211> 18 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1079 
tgcaccaagc ccacagca 18 
 
 
<210> 1080 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1080 
cgaaataatc atctgtccct cctgtttttc tcttggaaag aaagt 45 
 
 
<210> 1081 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1081 
gcacagcgcc agcagaggtt tttctcttgg aaagaaagt 39 
 
 
<210> 1082 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1082 
ggtaaaatct ccaggtaagg ctttttttct cttggaaaga aagt 44 
 
 
<210> 1083 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1083 
aaagatttgg gaagaaggtt cactttttct cttggaaaga aagt 44 
 
 
<210> 1084 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1084 
tgctcttcag cctttgcttt ttttttctct tggaaagaaa gt 42 
 
 
<210> 1085 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1085 
cagaggctgc agagaagaga aatttttctc ttggaaagaa agt 43 
 
 
<210> 1086 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1086 
cggctctggt gttgacggtt tttctcttgg aaagaaagt 39 
 
 
<210> 1087 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1087 
tgcctgggcc tcaggtacat ttttctcttg gaaagaaagt  40 
 
 
<210> 1088 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1088 
agcaggcaac tctcaggcaa tttttgaagt taccgtttt 39 
 
 
<210> 1089 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1089 
cgaatcactg tgtccgtggt gtttttctga gtcaaagcat  40 
 
 
<210> 1090 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1090 
agtaatgtat gcccctaagt agcttttttt gaagttaccg tttt 44 
 
 
<210> 1091 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1091 
agatggagga ggcttccact ttttttctga gtcaaagcat  40 
 
 
<210> 1092 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1092 
catgcttttc tgaaactaaa aaggtttttt gaagttaccg tttt 44 
 
 
<210> 1093 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1093 
ccaaagagat cggtgcccag tttttctgag tcaaagcat 39 
 
 
<210> 1094 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1094 
cagggcaggt atacgccttg tttttgaagt taccgtttt 39 
 
 
<210> 1095 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1095 
cacttccggc tccaaacaaa tttttctgag tcaaagcat 39 
 
 
<210> 1096 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1096 
tgtcaacagc ctccgcaaat ttttgaagtt accgtttt 38 
 
 
<210> 1097 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1097 
gggcactgta gctgaagatg ctttttctga gtcaaagcat  40 
 
 
<210> 1098 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1098 
gcagaaaggc attcccgctt tttgaagtta ccgtttt 37 
 
 
<210> 1099 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1099 
tgcacaggtg tccggctctt ttttctgagt caaagcat 38 
 
 
<210> 1100 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1100 
ggtccaggta cggagcgagt ttttgaagtt accgtttt 38 
 
 
<210> 1101 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1101 
catgtgggct atgattcagc atttttctga gtcaaagcat  40 
 
 
<210> 1102 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1102 
taaacgctgc ttttacctgg atttttgaag ttaccgtttt  40 
 
 
<210> 1103 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human SETD4 
  
<400> 1103 
taatttcgta agaatgagtt tcttcatttt ttctgagtca aagcat 46 
 
 

<210> 1104 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1104 
taactgggat ggatattgac agg 23 
 
 
<210> 1105 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1105 
tgattttcac cgcaagacat gta 23 
 
 
<210> 1106 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1106 
ggtttggggg tctgacacca  20 
 
 
<210> 1107 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1107 
ggccagctgg gacttaagct  20 
 
 
<210> 1108 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1108 
gcctgtgctg ctcgaggatt tttctcttgg aaagaaagt 39 
 
 
<210> 1109 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1109 
tgaagaagaa gaccgcttgc tttttttctc ttggaaagaa agt 43 
 
 
<210> 1110 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1110 
catgaggacc tcgattgcgt ttttctcttg gaaagaaagt  40 
 
 
<210> 1111 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1111 
cgcggggatg atgggctttt tctcttggaa agaaagt 37 
 
 
<210> 1112 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1112 
gcttggggaa gaaggtgcat ttttctcttg gaaagaaagt  40 
 
 
<210> 1113 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1113 
ccttccagaa cgcctcatga tttttctctt ggaaagaaag t 41 
 
 
<210> 1114 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1114 
tccttcagct tggttttgag gttttttctc ttggaaagaa agt 43 
 
 
<210> 1115 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1115 
gagtgccaac tgggcctcta ctttttctct tggaaagaaa gt 42 
 
 
<210> 1116 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1116 
tttcacaagg cctgactttg attttttgaa gttaccgttt t 41 
 
 
<210> 1117 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1117 
gctaaaatca gcttcactac ctggtttttc tgagtcaaag cat 43 
 
 
<210> 1118 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1118 
cctcaggagc ggaaatgctt ttttgaagtt accgtttt 38 
 
 
<210> 1119 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1119 
cccgcagtcg acatatggat ttttctgagt caaagcat 38 
 
 
<210> 1120 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1120 
cgaagctcca ttactccgcc tttttgaagt taccgtttt 39 
 
 
<210> 1121 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1121 
tgctgccagg cttgtgtgat ttttctgagt caaagcat 38 
 
 
<210> 1122 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1122 
catggacaga aggtcctttt cctttttgaa gttaccgttt t 41 
 
 
<210> 1123 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1123 
gctcagctga ttcctgcaca gtttttctga gtcaaagcat  40 
 
 
<210> 1124 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1124 
tttgtaggag cctgagttgc tacttttttg aagttaccgt ttt 43 
 
 
<210> 1125 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1125 
tggggctaca gtcgcttcct ttttctgagt caaagcat 38 
 
 
<210> 1126 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1126 
gcagtggagt caaatactgc tctgtttttg aagttaccgt ttt 43 
 
 
<210> 1127 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1127 
gtctcactgt cacctctttc tgcttttttc tgagtcaaag cat 43 
 
 
<210> 1128 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1128 
atggagtcgg cgctcagatt ttttgaagtt accgtttt 38 
 
 
<210> 1129 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1129 
ccacgatttc actttccctt tctttttctg agtcaaagca t 41 
 
 
<210> 1130 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1130 
ccagtcctct cgcatgcgtt tttgaagtta ccgtttt 37 
 
 
<210> 1131 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GOLSYN 
  
<400> 1131 
ccggtgacac tcctcctcaa ttttttctga gtcaaagcat  40 
 
 

<210> 1132 
<211> 16 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1132 
tggagcttgg gggccg 16 
 
 
<210> 1133 
<211> 14 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1133 
gcccgggccc cctc 14 
 
 
<210> 1134 
<211> 13 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1134 
cccggcgccg gcc 13 
 
 
<210> 1135 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1135 
catgcttcag agccccacac  20 
 
 
<210> 1136 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1136 
ccacttgtac aacaccccct c 21 
 
 
<210> 1137 
<211> 22 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1137 
gccatcttta tgcttccttt gc 22 
 
 
<210> 1138 
<211> 25 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1138 
agtccttgta tcagtcaaac atgct 25 
 
 
<210> 1139 
<211> 27 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1139 
ggtttcactt atttcttttt ctttttt 27 
 
 
<210> 1140 
<211> 35 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1140 
cagcgggcgc agcgtttttc tcttggaaag aaagt 35 
 
 
<210> 1141 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1141 
ggcctttaga ggccgggatt tttctcttgg aaagaaagt 39 
 
 
<210> 1142 
<211> 36 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1142 
cgccggcacg aagccttttt ctcttggaaa gaaagt 36 
 
 
<210> 1143 
<211> 35 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1143 
gcccctcccg gccctttttc tcttggaaag aaagt 35 
 
 
<210> 1144 
<211> 36 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1144 
cgcgcatcct cccggttttt ctcttggaaa gaaagt 36 
 
 
<210> 1145 
<211> 48 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1145 
gctgaatgaa ctttaatttc acaaactttt ttctcttgga aagaaagt 48 
 
 
<210> 1146 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1146 
gctgcattca ctgccttcat gttttttctc ttggaaagaa agt 43 
 
 
<210> 1147 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1147 
ttttggtttt cagcgattca cttttttctc ttggaaagaa agt 43 
 
 
<210> 1148 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1148 
agacattccc gggtaagcct tttttgaagt taccgtttt 39 
 
 
<210> 1149 
<211> 33 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1149 
cgaggcgcgg gccctttttc tgagtcaaag cat 33 
 
 
<210> 1150 
<211> 35 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1150 
gccgcaggga cgtggctttt tgaagttacc gtttt 35 
 
 
<210> 1151 
<211> 36 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1151 
gctttctgcc tgcgcgcttt ttctgagtca aagcat 36 
 
 
<210> 1152 
<211> 34 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1152 
gcagggcctg gggcattttt gaagttaccg tttt 34 
 
 
<210> 1153 
<211> 36 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1153 
gcggtgatgg ggtaggcttt ttctgagtca aagcat 36 
 
 
<210> 1154 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1154 
gccagcctgt gagatagttg gttttttgaa gttaccgttt t 41 
 
 
<210> 1155 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1155 
tctaaaacaa accaacgagg cttttttctg agtcaaagca t 41 
 
 
<210> 1156 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1156 
tgaatcatag taggataaga ttccattatt tttgaagtta ccgtttt 47 
 
 
<210> 1157 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1157 
tccctttgca aacatcatct tgtttttctg agtcaaagca t 41 
 
 
<210> 1158 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1158 
tgattaattc cattcttgtg ttgtcttttt tgaagttacc gtttt 45 
 
 
<210> 1159 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1159 
agaaatgctg ctctccagga atttttctga gtcaaagcat  40 
 
 
<210> 1160 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1160 
accagccacc tctgtctttc atttttgaag ttaccgtttt  40 
 
 
<210> 1161 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1161 
ttggagctcc ccagagcgtt tttctgagtc aaagcat 37 
 
 
<210> 1162 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1162 
cacagtagag gcgaagttca gacatttttg aagttaccgt ttt 43 
 
 
<210> 1163 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human PLEKHA3 
  
<400> 1163 
tatgaacttg ctgcattaag aggttttttc tgagtcaaag cat 43 
 
 

<210> 1164 
<211> 29 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1164 
cattcaaatt tcttatgact gataattta 29 
 
 
<210> 1165 
<211> 24 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1165 
cttggtcaat gaagagaact tggt 24 
 
 
<210> 1166 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1166 
ccgctttagc agccagagtt gtttttctct tggaaagaaa gt 42 
 
 
<210> 1167 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1167 
tagactgcag caggtggcag tttttctctt ggaaagaaag t 41 
 
 
<210> 1168 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1168 
aatagtttgt tgcgagagga agctttttct cttggaaaga aagt 44 
 
 
<210> 1169 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1169 
atcttcaaat agaggccgat ttctttttct cttggaaaga aagt 44 
 
 
<210> 1170 
<211> 48 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1170 
cctctaggct ggctatcttt atacatattt ttctcttgga aagaaagt 48 
 
 
<210> 1171 
<211> 48 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1171 
cacttcacag agatagttac agccatattt ttctcttgga aagaaagt 48 
 
 
<210> 1172 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1172 
tgcactggga gacaattcct ttttttgaag ttaccgtttt  40 
 
 
<210> 1173 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1173 
gcagccagga gggcaaaatt tttctgagtc aaagcat 37 
 
 
<210> 1174 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1174 
ttcctcttcc cgaagctgtg tttttgaagt taccgtttt 39 
 
 
<210> 1175 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1175 
gatctggaag gtctgaggtt ccttttttct gagtcaaagc at 42 
 
 
<210> 1176 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1176 
gccatcttta ttcctgcgac atttttgaag ttaccgtttt  40 
 
 
<210> 1177 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1177 
caattgtctt ctactggttc agcatttttc tgagtcaaag cat 43 
 
 
<210> 1178 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1178 
atttcattgc cacaaagttg atgtttttga agttaccgtt tt 42 
 
 
<210> 1179 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1179 
gctataaagt aaagcgtatt gtcaataatt tttctgagtc aaagcat 47 
 
 
<210> 1180 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1180 
gattccaggt tttcatcatc ttcatttttg aagttaccgt ttt 43 
 
 
<210> 1181 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1181 
gattcaagct tgccaaagta atcttttttc tgagtcaaag cat 43 
 
 
<210> 1182 
<211> 48 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1182 
gcattatctc tacagtcaga atcagtcatt ttttgaagtt accgtttt 48 
 
 
<210> 1183 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human IL-18 
  
<400> 1183 
cttataataa atatggtccg gggttttttc tgagtcaaag cat 43 
 
 

<210> 1184 
<211> 23 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1184 
ggcaacaata tccactttac cag 23 
 
 
<210> 1185 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1185 
gacgtactca gcgccagcat  20 
 
 
<210> 1186 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1186 
gaggctgcgg gctcaatttt tttctcttgg aaagaaagt 39 
 
 
<210> 1187 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1187 
tggcgacgca aaagaagatg tttttctctt ggaaagaaag t 41 
 
 
<210> 1188 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1188 
caaatccgtt gactccgacc ttttttctct tggaaagaaa gt 42 
 
 
<210> 1189 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1189 
ggtcaatgaa ggggtcattg attttttctc ttggaaagaa agt 43 
 
 
<210> 1190 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1190 
ccttgacggt gccatggaat tttttctctt ggaaagaaag t 41 
 
 
<210> 1191 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1191 
aagacgccag tggactccac tttttctctt ggaaagaaag t 41 
 
 
<210> 1192 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1192 
ggagcagaga gcgaagcggt ttttgaagtt accgtttt 38 
 
 
<210> 1193 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1193 
cggctgactg tcgaacagga tttttctgag tcaaagcat 39 
 
 
<210> 1194 
<211> 36 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1194 
gagcgatgtg gctcggcttt ttgaagttac cgtttt 36 
 
 
<210> 1195 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1195 
tcaccttccc catggtgtct tttttctgag tcaaagcat 39 
 
 
<210> 1196 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1196 
ccaggcgccc aatacgactt tttgaagtta ccgtttt 37 
 
 
<210> 1197 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1197 
agttaaaagc agccctggtg atttttctga gtcaaagcat  40 
 
 
<210> 1198 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1198 
tggaacatgt aaaccatgta gttgattttt gaagttaccg tttt 44 
 
 
<210> 1199 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1199 
ttgccatggg tggaatcata ttttttctga gtcaaagcat  40 
 
 
<210> 1200 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1200 
tgacaagctt cccgttctca gtttttgaag ttaccgtttt  40 
 
 
<210> 1201 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1201 
tggtgatggg atttccattg atttttctga gtcaaagcat  40 
 
 
<210> 1202 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1202 
gggatctcgc tcctggaaga tttttgaagt taccgtttt 39 
 
 
<210> 1203 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the artificial sequence: bDNA probes for human GAPDH 
  
<400> 1203 
cgccccactt gattttggat ttttctgagt caaagcat 38 
 
 

