<110> F. Hoffmann-La Roche AG 
  
<120> COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF KIF10 GENES 

<130> Case 26432 WO

<150>  EP09175385.5  
<151>  2009-11-09
	 
  
<160> 1002 


<210> 1 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 1 
cuuugaagac cgagcuuuc 19 
 
 
<210> 2 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 2 
gaaagcucgg ucuucaaag 19 
 
 
<210> 3 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 3 
guuagagagu guuauagca 19 
 
 
<210> 4 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 4 
ugcuauaaca cucucuaac 19 
 
 
<210> 5 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 5 
caaugcaagg aacggaauu 19 
 
 
<210> 6 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 6 
aauuccguuc cuugcauug 19 
 
 
<210> 7 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 7 
acguguaucu uacauggaa 19 
 
 
<210> 8 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 8 
uuccauguaa gauacacgu 19 
 
 
<210> 9 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 9 
ugcugaaacu guagcccuu 19 
 
 
<210> 10 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 10 
aagggcuaca guuucagca 19 
 
 
<210> 11 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 11 
ccuuagagaa acuauaacu 19 
 
 
<210> 12 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 12 
aguuauaguu ucucuaagg 19 
 
 
<210> 13 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 13 
ucauaaggag aguagaguu 19 
 
 
<210> 14 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 14 
aacucuacuc uccuuauga 19 
 
 
<210> 15 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 15 
ggcuguaaua uaaaucgaa 19 
 
 
<210> 16 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 16 
uucgauuuau auuacagcc 19 
 
 
<210> 17 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 17 
uuuuuugaua gccgaucaa 19 
 
 
<210> 18 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 18 
uugaucggcu aucaaaaaa 19 
 
 
<210> 19 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 19 
caagaacagu ccuuaaaua 19 
 
 
<210> 20 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 20 
uauuuaagga cuguucuug 19 
 
 
<210> 21 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 21 
auagcaaguu aacacgaau 19 
 
 
<210> 22 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 22 
auucguguua acuugcuau 19 
 
 
<210> 23 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 23 
augagugcuu gaauagauu 19 
 
 
<210> 24 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 24 
aaucuauuca agcacucau 19 
 
 
<210> 25 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 25 
ugagcaaaag uauaagaug 19 
 
 
<210> 26 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 26 
caucuuauac uuuugcuca 19 
 
 
<210> 27 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 27 
uagauugucu cuugacuug 19 
 
 
<210> 28 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 28 
caagucaaga gacaaucua 19 
 
 
<210> 29 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 29 
gaccgagcuu ucuuacaag 19 
 
 
<210> 30 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 30 
cuuguaagaa agcucgguc 19 
 
 
<210> 31 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 31 
uagcaaguua acacgaauu 19 
 
 
<210> 32 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 32 
aauucguguu aacuugcua 19 
 
 
<210> 33 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 33 
gauagcaagu uaacacgaa 19 
 
 
<210> 34 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 34 
uucguguuaa cuugcuauc 19 
 
 
<210> 35 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 35 
gaacauauaa ggcuagaaa 19 
 
 
<210> 36 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 36 
uuucuagccu uauauguuc 19 
 
 
<210> 37 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 37 
agacacguau uaucugcac 19 
 
 
<210> 38 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 38 
gugcagauaa uacgugucu 19 
 
 
<210> 39 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 39 
aucuaagaag aguagagga 19 
 
 
<210> 40 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 40 
uccucuacuc uucuuagau 19 
 
 
<210> 41 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 41 
cauacaaggc uacaauggu 19 
 
 
<210> 42 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 42 
accauuguag ccuuguaug 19 
 
 
<210> 43 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 43 
aucauuauga gugcuugaa 19 
 
 
<210> 44 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 44 
uucaagcacu cauaaugau 19 
 
 
<210> 45 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 45 
uccugaaaag guauagaaa 19 
 
 
<210> 46 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 46 
uuucuauacc uuuucagga 19 
 
 
<210> 47 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 47 
gcuacaaugg uacuauauu 19 
 
 
<210> 48 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 48 
aauauaguac cauuguagc 19 
 
 
<210> 49 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 49 
aucugaagag cuccauaua 19 
 
 
<210> 50 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 50 
uauauggagc ucuucagau 19 
 
 
<210> 51 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 51 
ucaucgauuc ugccauaca 19 
 
 
<210> 52 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 52 
uguauggcag aaucgauga 19 
 
 
<210> 53 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 53 
auuaucgaga uagcaaguu 19 
 
 
<210> 54 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 54 
aacuugcuau cucgauaau 19 
 
 
<210> 55 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 55 
uagaaaguaa gaugcucga 19 
 
 
<210> 56 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 56 
ucgagcaucu uacuuucua 19 
 
 
<210> 57 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 57 
agcucaagga aaaccuuag 19 
 
 
<210> 58 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 58 
cuaagguuuu ccuugagcu 19 
 
 
<210> 59 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 59 
agcccuugaa guuaaacau 19 
 
 
<210> 60 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 60 
auguuuaacu ucaagggcu 19 
 
 
<210> 61 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 61 
guauaagaug guccuugag 19 
 
 
<210> 62 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 62 
cucaaggacc aucuuauac 19 
 
 
<210> 63 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 63 
gcuuugaaga ccgagcuuu 19 
 
 
<210> 64 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 64 
aaagcucggu cuucaaagc 19 
 
 
<210> 65 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 65 
ccgaucaaag ucuuuacca 19 
 
 
<210> 66 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 66 
ugguaaagac uuugaucgg 19 
 
 
<210> 67 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 67 
gcucaaggaa aaccuuaga 19 
 
 
<210> 68 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 68 
ucuaagguuu uccuugagc 19 
 
 
<210> 69 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 69 
ucgagaagau gucaauagg 19 
 
 
<210> 70 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 70 
ccuauugaca ucuucucga 19 
 
 
<210> 71 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 71 
auccuucaau uuugaucgu 19 
 
 
<210> 72 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 72 
acgaucaaaa uugaaggau 19 
 
 
<210> 73 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 73 
acuccaguau cuuuugaug 19 
 
 
<210> 74 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 74 
caucaaaaga uacuggagu 19 
 
 
<210> 75 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 75 
aacucaaaag ugauauuca 19 
 
 
<210> 76 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 76 
ugaauaucac uuuugaguu 19 
 
 
<210> 77 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 77 
uaugagugcu ugaauagau 19 
 
 
<210> 78 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 78 
aucuauucaa gcacucaua 19 
 
 
<210> 79 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 79 
uuugaagacc gagcuuucu 19 
 
 
<210> 80 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 80 
agaaagcucg gucuucaaa 19 
 
 
<210> 81 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 81 
gacucagaua cuacaugaa 19 
 
 
<210> 82 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 82 
uucauguagu aucugaguc 19 
 
 
<210> 83 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 83 
ucauccaguu cgcuauuuu 19 
 
 
<210> 84 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 84 
aaaauagcga acuggauga 19 
 
 
<210> 85 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 85 
auacucguuu ugauauaga 19 
 
 
<210> 86 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 86 
ucuauaucaa aacgaguau 19 
 
 
<210> 87 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 87 
agagauggau gaucauuau 19 
 
 
<210> 88 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 88 
auaaugauca uccaucucu 19 
 
 
<210> 89 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 89 
aggacaaagu ugcuuuagg 19 
 
 
<210> 90 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 90 
ccuaaagcaa cuuuguccu 19 
 
 
<210> 91 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 91 
aucgagauag caaguuaac 19 
 
 
<210> 92 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 92 
guuaacuugc uaucucgau 19 
 
 
<210> 93 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 93 
cagagaugga ugaucauua 19 
 
 
<210> 94 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 94 
uaaugaucau ccaucucug 19 
 
 
<210> 95 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 95 
ugaguugaac ucacuucgu 19 
 
 
<210> 96 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 96 
acgaagugag uucaacuca 19 
 
 
<210> 97 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 97 
cucucaaugc aaggaacgg 19 
 
 
<210> 98 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 98 
ccguuccuug cauugagag 19 
 
 
<210> 99 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 99 
gagagaaaag ugcucuaga 19 
 
 
<210> 100 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 100 
ucuagagcac uuuucucuc 19 
 
 
<210> 101 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 101 
aggaaggcug uaauauaaa 19 
 
 
<210> 102 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 102 
uuuauauuac agccuuccu 19 
 
 
<210> 103 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 103 
ccagguuaau ccuaccaca 19 
 
 
<210> 104 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 104 
ugugguagga uuaaccugg 19 
 
 
<210> 105 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 105 
ccagcaacaa agcuacuaa 19 
 
 
<210> 106 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 106 
uuaguagcuu uguugcugg 19 
 
 
<210> 107 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 107 
gcagcaccaa ucaucgauu 19 
 
 
<210> 108 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 108 
aaucgaugau uggugcugc 19 
 
 
<210> 109 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 109 
gugaacauau aaggcuaga 19 
 
 
<210> 110 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 110 
ucuagccuua uauguucac 19 
 
 
<210> 111 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 111 
cacaagacaa uaagaaucc 19 
 
 
<210> 112 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 112 
ggauucuuau ugucuugug 19 
 
 
<210> 113 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 113 
ucucuuacgu guaucuuac 19 
 
 
<210> 114 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 114 
guaagauaca cguaagaga 19 
 
 
<210> 115 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 115 
gugucuuuca ugguaauga 19 
 
 
<210> 116 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 116 
ucauuaccau gaaagacac 19 
 
 
<210> 117 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 117 
cggagaauau aagguugac 19 
 
 
<210> 118 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 118 
gucaaccuua uauucuccg 19 
 
 
<210> 119 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 119 
uaaucuggua uuagacuau 19 
 
 
<210> 120 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 120 
auagucuaau accagauua 19 
 
 
<210> 121 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 121 
uaagguugac ucagauacu 19 
 
 
<210> 122 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 122 
aguaucugag ucaaccuua 19 
 
 
<210> 123 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 123 
cuuucuuaca agacccaag 19 
 
 
<210> 124 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 124 
cuugggucuu guaagaaag 19 
 
 
<210> 125 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 125 
aagguugacu cagauacua 19 
 
 
<210> 126 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 126 
uaguaucuga gucaaccuu 19 
 
 
<210> 127 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 127 
uagggaauuu cucuuacgu 19 
 
 
<210> 128 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 128 
acguaagaga aauucccua 19 
 
 
<210> 129 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 129 
agaaaagugc ucuagaaua 19 
 
 
<210> 130 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 130 
uauucuagag cacuuuucu 19 
 
 
<210> 131 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 131 
uagcagcacc aaucaucga 19 
 
 
<210> 132 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 132 
ucgaugauug gugcugcua 19 
 
 
<210> 133 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 133 
caccucaucc aguucgcua 19 
 
 
<210> 134 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 134 
uagcgaacug gaugaggug 19 
 
 
<210> 135 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 135 
cagcaccaau caucgauuc 19 
 
 
<210> 136 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 136 
gaaucgauga uuggugcug 19 
 
 
<210> 137 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 137 
uucagcacua cuaaggaua 19 
 
 
<210> 138 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 138 
uauccuuagu agugcugaa 19 
 
 
<210> 139 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 139 
uucgugcuga cuaugauaa 19 
 
 
<210> 140 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 140 
uuaucauagu cagcacgaa 19 
 
 
<210> 141 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 141 
augagaguua aagcaaacc 19 
 
 
<210> 142 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 142 
gguuugcuuu aacucucau 19 
 
 
<210> 143 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 143 
guaguucaua aggagagua 19 
 
 
<210> 144 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 144 
uacucuccuu augaacuac 19 
 
 
<210> 145 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 145 
aucgugucuu ucaugguaa 19 
 
 
<210> 146 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 146 
uuaccaugaa agacacgau 19 
 
 
<210> 147 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 147 
aacaacuucu uaauguaca 19 
 
 
<210> 148 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 148 
uguacauuaa gaaguuguu 19 
 
 
<210> 149 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 149 
auaaucuggu auuagacua 19 
 
 
<210> 150 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 150 
uagucuaaua ccagauuau 19 
 
 
<210> 151 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 151 
uuugauagcc gaucaaagu 19 
 
 
<210> 152 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 152 
acuuugaucg gcuaucaaa 19 
 
 
<210> 153 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 153 
gguacuauau uugccuaug 19 
 
 
<210> 154 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 154 
cauaggcaaa uauaguacc 19 
 
 
<210> 155 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 155 
ugguuucaua aauuaucga 19 
 
 
<210> 156 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 156 
ucgauaauuu augaaacca 19 
 
 
<210> 157 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 157 
uaugcuauca aaagaacac 19 
 
 
<210> 158 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 158 
guguucuuuu gauagcaua 19 
 
 
<210> 159 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 159 
ucuuuaccau caccucauc 19 
 
 
<210> 160 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 160 
gaugagguga ugguaaaga 19 
 
 
<210> 161 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 161 
ggagaauaua agguugacu 19 
 
 
<210> 162 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 162 
agucaaccuu auauucucc 19 
 
 
<210> 163 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 163 
agcuuucaau gagaguuaa 19 
 
 
<210> 164 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 164 
uuaacucuca uugaaagcu 19 
 
 
<210> 165 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 165 
caugguaaug aaacuacca 19 
 
 
<210> 166 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 166 
ugguaguuuc auuaccaug 19 
 
 
<210> 167 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 167 
auggugauag caauaccuu 19 
 
 
<210> 168 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 168 
aagguauugc uaucaccau 19 
 
 
<210> 169 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 169 
gcaccaauca ucgauucug 19 
 
 
<210> 170 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 170 
cagaaucgau gauuggugc 19 
 
 
<210> 171 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 171 
cuaauucaug aaauuucga 19 
 
 
<210> 172 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 172 
ucgaaauuuc augaauuag 19 
 
 
<210> 173 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 173 
agagaguguu auagcagaa 19 
 
 
<210> 174 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 174 
uucugcuaua acacucucu 19 
 
 
<210> 175 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 175 
uauguugcug aucucacag 19 
 
 
<210> 176 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 176 
cugugagauc agcaacaua 19 
 
 
<210> 177 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 177 
auguuaauga gguaucaac 19 
 
 
<210> 178 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 178 
guugauaccu cauuaacau 19 
 
 
<210> 179 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 179 
cagcacuacu aaggauaga 19 
 
 
<210> 180 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 180 
ucuauccuua guagugcug 19 
 
 
<210> 181 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 181 
gacaagugau caagaaacu 19 
 
 
<210> 182 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 182 
aguuucuuga ucacuuguc 19 
 
 
<210> 183 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 183 
caauugaaga cugaccuaa 19 
 
 
<210> 184 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 184 
uuaggucagu cuucaauug 19 
 
 
<210> 185 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 185 
gcaaaacuca guagacucc 19 
 
 
<210> 186 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 186 
ggagucuacu gaguuuugc 19 
 
 
<210> 187 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 187 
uauagauggc aaaguucca 19 
 
 
<210> 188 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 188 
uggaacuuug ccaucuaua 19 
 
 
<210> 189 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 189 
ugauagccga ucaaagucu 19 
 
 
<210> 190 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 190 
agacuuugau cggcuauca 19 
 
 
<210> 191 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 191 
agauagcaag uuaacacga 19 
 
 
<210> 192 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 192 
ucguguuaac uugcuaucu 19 
 
 
<210> 193 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 193 
cuuacgugua ucuuacaug 19 
 
 
<210> 194 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 194 
cauguaagau acacguaag 19 
 
 
<210> 195 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 195 
ucgauucugc cauacaagg 19 
 
 
<210> 196 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 196 
ccuuguaugg cagaaucga 19 
 
 
<210> 197 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 197 
gagugguuaa auacucguu 19 
 
 
<210> 198 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 198 
aacgaguauu uaaccacuc 19 
 
 
<210> 199 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 199 
auagaaagug aguugaacu 19 
 
 
<210> 200 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 200 
aguucaacuc acuuucuau 19 
 
 
<210> 201 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 201 
aaccacagag aaaauucga 19 
 
 
<210> 202 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 202 
ucgaauuuuc ucugugguu 19 
 
 
<210> 203 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 203 
ucgagauagc aaguuaaca 19 
 
 
<210> 204 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 204 
uguuaacuug cuaucucga 19 
 
 
<210> 205 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 205 
uggcucagaa acuuaauga 19 
 
 
<210> 206 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 206 
ucauuaaguu ucugagcca 19 
 
 
<210> 207 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 207 
ucaaggaagg cuguaauau 19 
 
 
<210> 208 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 208 
auauuacagc cuuccuuga 19 
 
 
<210> 209 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 209 
ucagagaugg augaucauu 19 
 
 
<210> 210 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 210 
aaugaucauc caucucuga 19 
 
 
<210> 211 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 211 
auuauaaaag cacugauca 19 
 
 
<210> 212 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 212 
ugaucagugc uuuuauaau 19 
 
 
<210> 213 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 213 
ccagagaauu aagggaucu 19 
 
 
<210> 214 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 214 
agaucccuua auucucugg 19 
 
 
<210> 215 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 215 
cucauccagu ucgcuauuu 19 
 
 
<210> 216 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 216 
aaauagcgaa cuggaugag 19 
 
 
<210> 217 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 217 
caugacuuag cauauucca 19 
 
 
<210> 218 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 218 
uggaauaugc uaagucaug 19 
 
 
<210> 219 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 219 
uuacguguau cuuacaugg 19 
 
 
<210> 220 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 220 
ccauguaaga uacacguaa 19 
 
 
<210> 221 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 221 
aacucaguag acuccucuu 19 
 
 
<210> 222 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 222 
aagaggaguc uacugaguu 19 
 
 
<210> 223 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 223 
auuuugaucg ugucuuuca 19 
 
 
<210> 224 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 224 
ugaaagacac gaucaaaau 19 
 
 
<210> 225 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 225 
cuaaaucagg agaauauag 19 
 
 
<210> 226 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 226 
cuauauucuc cugauuuag 19 
 
 
<210> 227 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 227 
gaaagaagug cuaccauau 19 
 
 
<210> 228 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 228 
auaugguagc acuucuuuc 19 
 
 
<210> 229 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 229 
ugagauaaca aaacucacc 19 
 
 
<210> 230 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 230 
ggugaguuuu guuaucuca 19 
 
 
<210> 231 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 231 
ggcuacaaug guacuauau 19 
 
 
<210> 232 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 232 
auauaguacc auuguagcc 19 
 
 
<210> 233 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 233 
acaauuacga aaugcucuu 19 
 
 
<210> 234 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 234 
aagagcauuu cguaauugu 19 
 
 
<210> 235 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 235 
ucaaaaguga uauucacga 19 
 
 
<210> 236 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 236 
ucgugaauau cacuuuuga 19 
 
 
<210> 237 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 237 
auagauggca aaguuccaa 19 
 
 
<210> 238 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 238 
uuggaacuuu gccaucuau 19 
 
 
<210> 239 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 239 
aagugauauu cacgauacu 19 
 
 
<210> 240 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 240 
aguaucguga auaucacuu 19 
 
 
<210> 241 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 241 
agcaccaauc aucgauucu 19 
 
 
<210> 242 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 242 
agaaucgaug auuggugcu 19 
 
 
<210> 243 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 243 
ggaauuucuc uuacgugua 19 
 
 
<210> 244 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 244 
uacacguaag agaaauucc 19 
 
 
<210> 245 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 245 
aauuggccca acuuuugga 19 
 
 
<210> 246 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 246 
uccaaaaguu gggccaauu 19 
 
 
<210> 247 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 247 
auacccaaac acuaacugc 19 
 
 
<210> 248 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 248 
gcaguuagug uuuggguau 19 
 
 
<210> 249 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 249 
uugauagccg aucaaaguc 19 
 
 
<210> 250 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 250 
gacuuugauc ggcuaucaa 19 
 
 
<210> 251 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 251 
auaccuuaca cauucaaua 19 
 
 
<210> 252 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 252 
uauugaaugu guaagguau 19 
 
 
<210> 253 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 253 
gcuguaauau aaaucgaag 19 
 
 
<210> 254 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 254 
cuucgauuua uauuacagc 19 
 
 
<210> 255 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 255 
uuuuaauacc uuacacauu 19 
 
 
<210> 256 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 256 
aauguguaag guauuaaaa 19 
 
 
<210> 257 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 257 
acccagggca auucaugac 19 
 
 
<210> 258 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 258 
gucaugaauu gcccugggu 19 
 
 
<210> 259 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 259 
uuuuugauag ccgaucaaa 19 
 
 
<210> 260 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 260 
uuugaucggc uaucaaaaa 19 
 
 
<210> 261 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 261 
ucugguauua gacuaugaa 19 
 
 
<210> 262 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 262 
uucauagucu aauaccaga 19 
 
 
<210> 263 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 263 
agguugacuc agauacuac 19 
 
 
<210> 264 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 264 
guaguaucug agucaaccu 19 
 
 
<210> 265 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 265 
guugaacuca cuucgugcu 19 
 
 
<210> 266 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 266 
agcacgaagu gaguucaac 19 
 
 
<210> 267 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 267 
agagaaauug aagcuacag 19 
 
 
<210> 268 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 268 
cuguagcuuc aauuucucu 19 
 
 
<210> 269 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 269 
cagguuaauc cuaccacac 19 
 
 
<210> 270 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 270 
gugugguagg auuaaccug 19 
 
 
<210> 271 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 271 
gaacuugagg ugacuaaug 19 
 
 
<210> 272 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 272 
cauuagucac cucaaguuc 19 
 
 
<210> 273 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 273 
uacguguauc uuacaugga 19 
 
 
<210> 274 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 274 
uccauguaag auacacgua 19 
 
 
<210> 275 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 275 
uauaagguug acucagaua 19 
 
 
<210> 276 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 276 
uaucugaguc aaccuuaua 19 
 
 
<210> 277 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 277 
acuauaacua gagaccuag 19 
 
 
<210> 278 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 278 
cuaggucucu aguuauagu 19 
 
 
<210> 279 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 279 
caaaagugau auucacgau 19 
 
 
<210> 280 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 280 
aucgugaaua ucacuuuug 19 
 
 
<210> 281 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 281 
acggagaaua uaagguuga 19 
 
 
<210> 282 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 282 
ucaaccuuau auucuccgu 19 
 
 
<210> 283 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 283 
augacuuagc auauuccaa 19 
 
 
<210> 284 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 284 
uuggaauaug cuaagucau 19 
 
 
<210> 285 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 285 
agcagcacca aucaucgau 19 
 
 
<210> 286 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 286 
aucgaugauu ggugcugcu 19 
 
 
<210> 287 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 287 
agcugucaau gagacucag 19 
 
 
<210> 288 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 288 
cugagucuca uugacagcu 19 
 
 
<210> 289 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 289 
auaaauuauc gagauagca 19 
 
 
<210> 290 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 290 
ugcuaucucg auaauuuau 19 
 
 
<210> 291 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 291 
agcacuacua aggauagaa 19 
 
 
<210> 292 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 292 
uucuauccuu aguagugcu 19 
 
 
<210> 293 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 293 
ugguuaaaua cucguuuug 19 
 
 
<210> 294 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 294 
caaaacgagu auuuaacca 19 
 
 
<210> 295 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 295 
aauacccaaa cacuaacug 19 
 
 
<210> 296 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 296 
caguuagugu uuggguauu 19 
 
 
<210> 297 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 297 
uugcaaauug agagggacc 19 
 
 
<210> 298 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 298 
ggucccucuc aauuugcaa 19 
 
 
<210> 299 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 299 
ugugugaaau agaacacuu 19 
 
 
<210> 300 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 300 
aaguguucua uuucacaca 19 
 
 
<210> 301 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 301 
acaggaauua aaggcuaaa 19 
 
 
<210> 302 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 302 
uuuagccuuu aauuccugu 19 
 
 
<210> 303 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 303 
uggccgucug cgugcgagu 19 
 
 
<210> 304 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 304 
acucgcacgc agacggcca 19 
 
 
<210> 305 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 305 
gucugcgugc gagugcggc 19 
 
 
<210> 306 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 306 
gccgcacucg cacgcagac 19 
 
 
<210> 307 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 307 
gguuacuaag ugauggaca 19 
 
 
<210> 308 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 308 
uguccaucac uuaguaacc 19 
 
 
<210> 309 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 309 
uucaugaaau uucgaacuu 19 
 
 
<210> 310 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 310 
aaguucgaaa uuucaugaa 19 
 
 
<210> 311 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 311 
gucguucuca uaccaucuu 19 
 
 
<210> 312 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 312 
aagaugguau gagaacgac 19 
 
 
<210> 313 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 313 
gcacuacuaa ggauagaaa 19 
 
 
<210> 314 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 314 
uuucuauccu uaguagugc 19 
 
 
<210> 315 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 315 
cucuuacgug uaucuuaca 19 
 
 
<210> 316 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 316 
uguaagauac acguaagag 19 
 
 
<210> 317 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 317 
aacucaccuc ccuuauaga 19 
 
 
<210> 318 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 318 
ucuauaaggg aggugaguu 19 
 
 
<210> 319 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 319 
gagauagcaa guuaacacg 19 
 
 
<210> 320 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 320 
cguguuaacu ugcuaucuc 19 
 
 
<210> 321 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 321 
ccuuaacuug uggaggugg 19 
 
 
<210> 322 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 322 
ccaccuccac aaguuaagg 19 
 
 
<210> 323 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 323 
aaaguaagau gcucgaguu 19 
 
 
<210> 324 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 324 
aacucgagca ucuuacuuu 19 
 
 
<210> 325 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 325 
uaauucauga aauuucgaa 19 
 
 
<210> 326 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 326 
uucgaaauuu caugaauua 19 
 
 
<210> 327 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 327 
aguugaacuc acuucgugc 19 
 
 
<210> 328 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 328 
gcacgaagug aguucaacu 19 
 
 
<210> 329 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 329 
augguaauga aacuaccaa 19 
 
 
<210> 330 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 330 
uugguaguuu cauuaccau 19 
 
 
<210> 331 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 331 
ugaacucacu ucgugcuga 19 
 
 
<210> 332 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 332 
ucagcacgaa gugaguuca 19 
 
 
<210> 333 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 333 
ucacuucgug cugacuaug 19 
 
 
<210> 334 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 334 
cauagucagc acgaaguga 19 
 
 
<210> 335 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 335 
uggugcccag guuaauccu 19 
 
 
<210> 336 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 336 
aggauuaacc ugggcacca 19 
 
 
<210> 337 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 337 
ggcagcggca uuguacaaa 19 
 
 
<210> 338 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 338 
uuuguacaau gccgcugcc 19 
 
 
<210> 339 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 339 
agguuucuuu agagacgcg 19 
 
 
<210> 340 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 340 
cgcgucucua aagaaaccu 19 
 
 
<210> 341 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 341 
gguuucauaa auuaucgag 19 
 
 
<210> 342 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 342 
cucgauaauu uaugaaacc 19 
 
 
<210> 343 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 343 
auucaugaaa uuucgaacu 19 
 
 
<210> 344 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 344 
aguucgaaau uucaugaau 19 
 
 
<210> 345 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 345 
aacaauuaga ggagguuuc 19 
 
 
<210> 346 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 346 
gaaaccuccu cuaauuguu 19 
 
 
<210> 347 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 347 
agugcggccg cugaacagc 19 
 
 
<210> 348 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 348 
gcuguucagc ggccgcacu 19 
 
 
<210> 349 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 349 
ggugcccagg uuaauccua 19 
 
 
<210> 350 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 350 
uaggauuaac cugggcacc 19 
 
 
<210> 351 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 351 
agaaaguaag augcucgag 19 
 
 
<210> 352 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 352 
cucgagcauc uuacuuucu 19 
 
 
<210> 353 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 353 
aaacucaccu cccuuauag 19 
 
 
<210> 354 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 354 
cuauaaggga ggugaguuu 19 
 
 
<210> 355 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 355 
aaguaagaug cucgaguug 19 
 
 
<210> 356 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 356 
caacucgagc aucuuacuu 19 
 
 
<210> 357 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 357 
ccuuaaggga aaugauagc 19 
 
 
<210> 358 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 358 
gcuaucauuu cccuuaagg 19 
 
 
<210> 359 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 359 
cccagguuaa uccuaccac 19 
 
 
<210> 360 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 360 
gugguaggau uaaccuggg 19 
 
 
<210> 361 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 361 
guggccgucu gcgugcgag 19 
 
 
<210> 362 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 362 
cucgcacgca gacggccac 19 
 
 
<210> 363 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 363 
aaucuaagaa gaguagagg 19 
 
 
<210> 364 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 364 
ccucuacucu ucuuagauu 19 
 
 
<210> 365 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 365 
cuggugccca gguuaaucc 19 
 
 
<210> 366 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 366 
ggauuaaccu gggcaccag 19 
 
 
<210> 367 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 367 
agaauaauug ccauaauga 19 
 
 
<210> 368 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 368 
ucauuauggc aauuauucu 19 
 
 
<210> 369 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 369 
uucaauuuug aucgugucu 19 
 
 
<210> 370 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 370 
agacacgauc aaaauugaa 19 
 
 
<210> 371 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 371 
uacaaggcua caaugguac 19 
 
 
<210> 372 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 372 
guaccauugu agccuugua 19 
 
 
<210> 373 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 373 
gcccagguua auccuacca 19 
 
 
<210> 374 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 374 
ugguaggauu aaccugggc 19 
 
 
<210> 375 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 375 
uugaacucac uucgugcug 19 
 
 
<210> 376 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 376 
cagcacgaag ugaguucaa 19 
 
 
<210> 377 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 377 
caauuggccc aacuuuugg 19 
 
 
<210> 378 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 378 
ccaaaaguug ggccaauug 19 
 
 
<210> 379 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 379 
aauggacuug ucauacuca 19 
 
 
<210> 380 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 380 
ugaguaugac aaguccauu 19 
 
 
<210> 381 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 381 
cauaaauuau cgagauagc 19 
 
 
<210> 382 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 382 
gcuaucucga uaauuuaug 19 
 
 
<210> 383 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 383 
gagcuaaaaa uuguucaca 19 
 
 
<210> 384 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 384 
ugugaacaau uuuuagcuc 19 
 
 
<210> 385 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 385 
aauaccuuac acauucaau 19 
 
 
<210> 386 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 386 
auugaaugug uaagguauu 19 
 
 
<210> 387 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 387 
agggaucuca aauugaacc 19 
 
 
<210> 388 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 388 
gguucaauuu gagaucccu 19 
 
 
<210> 389 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 389 
agccaggucc uuggcacgc 19 
 
 
<210> 390 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 390 
gcgugccaag gaccuggcu 19 
 
 
<210> 391 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 391 
agaauccuca uguuacauc 19 
 
 
<210> 392 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 392 
gauguaacau gaggauucu 19 
 
 
<210> 393 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 393 
auaacuucca guugacuaa 19 
 
 
<210> 394 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 394 
uuagucaacu ggaaguuau 19 
 
 
<210> 395 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 395 
gaauuucucu uacguguau 19 
 
 
<210> 396 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 396 
auacacguaa gagaaauuc 19 
 
 
<210> 397 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 397 
aaccucucac uucccuauu 19 
 
 
<210> 398 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 398 
aauagggaag ugagagguu 19 
 
 
<210> 399 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 399 
uggaagcuaa aaauaccca 19 
 
 
<210> 400 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 400 
uggguauuuu uagcuucca 19 
 
 
<210> 401 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 401 
cucacuucgu gcugacuau 19 
 
 
<210> 402 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 402 
auagucagca cgaagugag 19 
 
 
<210> 403 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 403 
agagugguua aauacucgu 19 
 
 
<210> 404 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 404 
acgaguauuu aaccacucu 19 
 
 
<210> 405 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 405 
gauacucaag aacaauuac 19 
 
 
<210> 406 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 406 
guaauuguuc uugaguauc 19 
 
 
<210> 407 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 407 
cuuauguuaa ugagguauc 19 
 
 
<210> 408 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 408 
gauaccucau uaacauaag 19 
 
 
<210> 409 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 409 
augucaauau gagucauaa 19 
 
 
<210> 410 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 410 
uuaugacuca uauugacau 19 
 
 
<210> 411 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 411 
aaaacacuga uuacugaga 19 
 
 
<210> 412 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 412 
ucucaguaau caguguuuu 19 
 
 
<210> 413 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 413 
agcagucguu cucauacca 19 
 
 
<210> 414 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 414 
ugguaugaga acgacugcu 19 
 
 
<210> 415 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 415 
gauaaucugg uauuagacu 19 
 
 
<210> 416 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 416 
agucuaauac cagauuauc 19 
 
 
<210> 417 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 417 
uguaauauaa aucgaagcu 19 
 
 
<210> 418 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 418 
agcuucgauu uauauuaca 19 
 
 
<210> 419 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 419 
agugauauuc acgauacug 19 
 
 
<210> 420 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 420 
caguaucgug aauaucacu 19 
 
 
<210> 421 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 421 
aauucaugaa auuucgaac 19 
 
 
<210> 422 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 422 
guucgaaauu ucaugaauu 19 
 
 
<210> 423 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 423 
aggcuguaau auaaaucga 19 
 
 
<210> 424 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 424 
ucgauuuaua uuacagccu 19 
 
 
<210> 425 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 425 
agguuaaucc uaccacaca 19 
 
 
<210> 426 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 426 
ugugugguag gauuaaccu 19 
 
 
<210> 427 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 427 
ggaucuguua agguauccc 19 
 
 
<210> 428 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 428 
gggauaccuu aacagaucc 19 
 
 
<210> 429 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 429 
caauuacgaa augcucuug 19 
 
 
<210> 430 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 430 
caagagcauu ucguaauug 19 
 
 
<210> 431 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 431 
aaaagugaua uucacgaua 19 
 
 
<210> 432 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 432 
uaucgugaau aucacuuuu 19 
 
 
<210> 433 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 433 
gagcuuucuu acaagaccc 19 
 
 
<210> 434 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 434 
gggucuugua agaaagcuc 19 
 
 
<210> 435 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 435 
gaugucaaua ugagucaua 19 
 
 
<210> 436 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 436 
uaugacucau auugacauc 19 
 
 
<210> 437 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 437 
gaagcagucg uucucauac 19 
 
 
<210> 438 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<400> 438 
guaugagaac gacugcuuc 19 
 
 
<210> 439 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 9, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 439 
acguguaucu uacauggaat t 21 
 
 
<210> 440 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 8, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 440 
uuccauguaa gauacacgut t 21 
 
 
<210> 441 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 10, 12, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 9, 11, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 441 
guuagagagu guuauagcat t 21 
 
 
<210> 442 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 442 
ugcuauaaca cucucuaact t 21 
 
 
<210> 443 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 11, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 10, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 443 
ggcuguaaua uaaaucgaat t 21 
 
 
<210> 444 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 10, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 444 
uucgauuuau auuacagcct t 21 
 
 
<210> 445 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 445 
ucauaaggag aguagaguut t 21 
 
 
<210> 446 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 446 
aacucuacuc uccuuaugat t 21 
 
 
<210> 447 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10, 11, 12, 13, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 447 
caagaacagu ccuuaaauat t 21 
 
 
<210> 448 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 448 
uauuuaagga cuguucuugt t 21 
 
 
<210> 449 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 10, 11, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 12, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 449 
cuuugaagac cgagcuuuct t 21 
 
 
<210> 450 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 450 
gaaagcucgg ucuucaaagt t 21 
 
 
<210> 451 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 9, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 451 
auagcaaguu aacacgaaut t 21 
 
 
<210> 452 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 452 
auucguguua acuugcuaut t 21 
 
 
<210> 453 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 12, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 453 
ccuuagagaa acuauaacut t 21 
 
 
<210> 454 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 454 
aguuauaguu ucucuaaggt t 21 
 
 
<210> 455 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 11, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 455 
ugcugaaacu guagcccuut t 21 
 
 
<210> 456 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 9, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 456 
aagggcuaca guuucagcat t 21 
 
 
<210> 457 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 9, 10, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 11, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 457 
augagugcuu gaauagauut t 21 
 
 
<210> 458 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 458 
aaucuauuca agcacucaut t 21 
 
 
<210> 459 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 459 
caaugcaagg aacggaauut t 21 
 
 
<210> 460 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 460 
aauuccguuc cuugcauugt t 21 
 
 
<210> 461 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 9, 12, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 7, 8, 10, 11, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 461 
uuuuuugaua gccgaucaat t 21 
 
 
<210> 462 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 462 
uugaucggcu aucaaaaaat t 21 
 
 
<210> 463 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 11, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 14, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 463 
uagauugucu cuugacuugt t 21 
 
 
<210> 464 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 464 
caagucaaga gacaaucuat t 21 
 
 
<210> 465 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 8, 9, 10, 11, 12, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 465 
gaccgagcuu ucuuacaagt t 21 
 
 
<210> 466 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 466 
cuuguaagaa agcucgguct t 21 
 
 
<210> 467 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 8, 9, 12, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 10, 11, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 467 
uagcaaguua acacgaauut t 21 
 
 
<210> 468 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 468 
aauucguguu aacuugcuat t 21 
 
 
<210> 469 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 10, 11, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 469 
gauagcaagu uaacacgaat t 21 
 
 
<210> 470 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 470 
uucguguuaa cuugcuauct t 21 
 
 
<210> 471 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 8, 13, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 9, 10, 11, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 471 
gaacauauaa ggcuagaaat t 21 
 
 
<210> 472 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 472 
uuucuagccu uauauguuct t 21 
 
 
<210> 473 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 8, 10, 11, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 9, 12, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 473 
agacacguau uaucugcact t 21 
 
 
<210> 474 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 8, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 474 
gugcagauaa uacgugucut t 21 
 
 
<210> 475 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 475 
aucuaagaag aguagaggat t 21 
 
 
<210> 476 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 476 
uccucuacuc uucuuagaut t 21 
 
 
<210> 477 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 10, 11, 13, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 7, 8, 9, 12, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 477 
cauacaaggc uacaauggut t 21 
 
 
<210> 478 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 478 
accauuguag ccuuguaugt t 21 
 
 
<210> 479 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 8, 12, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 9, 10, 11, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 479 
aucauuauga gugcuugaat t 21 
 
 
<210> 480 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 11, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 480 
uucaagcacu cauaaugaut t 21 
 
 
<210> 481 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 481 
uccugaaaag guauagaaat t 21 
 
 
<210> 482 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 482 
uuucuauacc uuuucaggat t 21 
 
 
<210> 483 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 11, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 9, 10, 12, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 483 
gcuacaaugg uacuauauut t 21 
 
 
<210> 484 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 484 
aauauaguac cauuguagct t 21 
 
 
<210> 485 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 11, 12, 13, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 9, 10, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 485 
aucugaagag cuccauauat t 21 
 
 
<210> 486 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 486 
uauauggagc ucuucagaut t 21 
 
 
<210> 487 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 8, 9, 10, 11, 13, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 12, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 487 
ucaucgauuc ugccauacat t 21 
 
 
<210> 488 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 488 
uguauggcag aaucgaugat t 21 
 
 
<210> 489 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 11, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 8, 9, 10, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 489 
auuaucgaga uagcaaguut t 21 
 
 
<210> 490 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 490 
aacuugcuau cucgauaaut t 21 
 
 
<210> 491 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 8, 13, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 491 
uagaaaguaa gaugcucgat t 21 
 
 
<210> 492 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 492 
ucgagcaucu uacuuucuat t 21 
 
 
<210> 493 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 493 
agcucaagga aaaccuuagt t 21 
 
 
<210> 494 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 494 
cuaagguuuu ccuugagcut t 21 
 
 
<210> 495 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 12, 13, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 9, 10, 11, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 495 
agcccuugaa guuaaacaut t 21 
 
 
<210> 496 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 496 
auguuuaacu ucaagggcut t 21 
 
 
<210> 497 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 9, 12, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 10, 11, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 497 
guauaagaug guccuugagt t 21 
 
 
<210> 498 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 10, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 498 
cucaaggacc aucuuauact t 21 
 
 
<210> 499 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 11, 12, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 9, 10, 13, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 499 
gcuuugaaga ccgagcuuut t 21 
 
 
<210> 500 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 500 
aaagcucggu cuucaaagct t 21 
 
 
<210> 501 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 11, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 8, 9, 10, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 501 
ccgaucaaag ucuuuaccat t 21 
 
 
<210> 502 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 502 
ugguaaagac uuugaucggt t 21 
 
 
<210> 503 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 9, 10, 11, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 503 
gcucaaggaa aaccuuagat t 21 
 
 
<210> 504 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 504 
ucuaagguuu uccuugagct t 21 
 
 
<210> 505 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 505 
ugagcaaaag uauaagaugt t 21 
 
 
<210> 506 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 8, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 506 
caucuuauac uuuugcucat t 21 
 
 
<210> 507 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 10, 12, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 9, 11, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 507 
ucgagaagau gucaauaggt t 21 
 
 
<210> 508 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 508 
ccuauugaca ucuucucgat t 21 
 
 
<210> 509 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 10, 11, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 8, 9, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 509 
auccuucaau uuugaucgut t 21 
 
 
<210> 510 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 510 
acgaucaaaa uugaaggaut t 21 
 
 
<210> 511 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 8, 10, 11, 12, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 9, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 511 
acuccaguau cuuuugaugt t 21 
 
 
<210> 512 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 512 
caucaaaaga uacuggagut t 21 
 
 
<210> 513 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 11, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 9, 10, 12, 13, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 513 
aacucaaaag ugauauucat t 21 
 
 
<210> 514 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 514 
ugaauaucac uuuugaguut t 21 
 
 
<210> 515 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 9, 10, 11, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 515 
uaugagugcu ugaauagaut t 21 
 
 
<210> 516 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 8, 12, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 11, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 516 
aucuauucaa gcacucauat t 21 
 
 
<210> 517 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 9, 10, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 11, 12, 13 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 517 
uuugaagacc gagcuuucut t 21 
 
 
<210> 518 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 518 
agaaagcucg gucuucaaat t 21 
 
 
<210> 519 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 9, 11, 12, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 10, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 519 
gacucagaua cuacaugaat t 21 
 
 
<210> 520 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 520 
uucauguagu aucugaguct t 21 
 
 
<210> 521 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 7, 8, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 521 
ucauccaguu cgcuauuuut t 21 
 
 
<210> 522 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 522 
aaaauagcga acuggaugat t 21 
 
 
<210> 523 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 9, 10, 11, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 523 
auacucguuu ugauauagat t 21 
 
 
<210> 524 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 524 
ucuauaucaa aacgaguaut t 21 
 
 
<210> 525 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 525 
agagauggau gaucauuaut t 21 
 
 
<210> 526 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 526 
auaaugauca uccaucucut t 21 
 
 
<210> 527 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 11, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 527 
aggacaaagu ugcuuuaggt t 21 
 
 
<210> 528 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 528 
ccuaaagcaa cuuuguccut t 21 
 
 
<210> 529 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 8, 11, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 9, 10, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 529 
aucgagauag caaguuaact t 21 
 
 
<210> 530 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 530 
guuaacuugc uaucucgaut t 21 
 
 
<210> 531 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 11, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 531 
cagagaugga ugaucauuat t 21 
 
 
<210> 532 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 8, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 532 
uaaugaucau ccaucucugt t 21 
 
 
<210> 533 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 8, 9, 13, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 533 
ugaguugaac ucacuucgut t 21 
 
 
<210> 534 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 534 
acgaagugag uucaacucat t 21 
 
 
<210> 535 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 8, 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 535 
cucucaaugc aaggaacggt t 21 
 
 
<210> 536 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 536 
ccguuccuug cauugagagt t 21 
 
 
<210> 537 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 537 
gagagaaaag ugcucuagat t 21 
 
 
<210> 538 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 538 
ucuagagcac uuuucucuct t 21 
 
 
<210> 539 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 9, 11, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 10, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 539 
aggaaggcug uaauauaaat t 21 
 
 
<210> 540 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 540 
uuuauauuac agccuuccut t 21 
 
 
<210> 541 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 10, 11, 12, 13, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 9, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 541 
ccagguuaau ccuaccacat t 21 
 
 
<210> 542 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 542 
ugugguagga uuaaccuggt t 21 
 
 
<210> 543 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 8, 13, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 9, 10, 11, 12, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 543 
ccagcaacaa agcuacuaat t 21 
 
 
<210> 544 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 544 
uuaguagcuu uguugcuggt t 21 
 
 
<210> 545 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 8, 11, 12, 14, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 9, 10, 13, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 545 
gcagcaccaa ucaucgauut t 21 
 
 
<210> 546 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 546 
aaucgaugau uggugcugct t 21 
 
 
<210> 547 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 10, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 9, 11, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 547 
gugaacauau aaggcuagat t 21 
 
 
<210> 548 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 548 
ucuagccuua uauguucact t 21 
 
 
<210> 549 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 8, 11, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 9, 10, 12, 13, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 549 
cacaagacaa uaagaaucct t 21 
 
 
<210> 550 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 550 
ggauucuuau ugucuugugt t 21 
 
 
<210> 551 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 7, 9, 11, 13, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 551 
ucucuuacgu guaucuuact t 21 
 
 
<210> 552 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 9, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 552 
guaagauaca cguaagagat t 21 
 
 
<210> 553 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 9, 11, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 10, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 553 
gugucuuuca ugguaaugat t 21 
 
 
<210> 554 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 554 
ucauuaccau gaaagacact t 21 
 
 
<210> 555 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 8, 10, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 555 
cggagaauau aagguugact t 21 
 
 
<210> 556 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 556 
gucaaccuua uauucuccgt t 21 
 
 
<210> 557 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 9, 11, 12, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 8, 10, 13, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 557 
uaaucuggua uuagacuaut t 21 
 
 
<210> 558 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 10, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 558 
auagucuaau accagauuat t 21 
 
 
<210> 559 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 10, 11, 12, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 8, 9, 13, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 559 
uaagguugac ucagauacut t 21 
 
 
<210> 560 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 560 
aguaucugag ucaaccuuat t 21 
 
 
<210> 561 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 8, 10, 11, 12, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 561 
cuuucuuaca agacccaagt t 21 
 
 
<210> 562 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 562 
cuugggucuu guaagaaagt t 21 
 
 
<210> 563 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 9, 10, 11, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 8, 12, 13, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 563 
aagguugacu cagauacuat t 21 
 
 
<210> 564 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 564 
uaguaucuga gucaaccuut t 21 
 
 
<210> 565 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 8, 9, 10, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 565 
uagggaauuu cucuuacgut t 21 
 
 
<210> 566 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 566 
acguaagaga aauucccuat t 21 
 
 
<210> 567 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 10, 11, 12, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 567 
agaaaagugc ucuagaauat t 21 
 
 
<210> 568 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 568 
uauucuagag cacuuuucut t 21 
 
 
<210> 569 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 9, 10, 13, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 8, 11, 12, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 569 
uagcagcacc aaucaucgat t 21 
 
 
<210> 570 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 570 
ucgaugauug gugcugcuat t 21 
 
 
<210> 571 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 10, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 7, 11, 12, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 571 
caccucaucc aguucgcuat t 21 
 
 
<210> 572 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 572 
uagcgaacug gaugaggugt t 21 
 
 
<210> 573 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 10, 11, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 9, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 573 
cagcaccaau caucgauuct t 21 
 
 
<210> 574 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 574 
gaaucgauga uuggugcugt t 21 
 
 
<210> 575 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 8, 9, 11, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 10, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 575 
uucagcacua cuaaggauat t 21 
 
 
<210> 576 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 576 
uauccuuagu agugcugaat t 21 
 
 
<210> 577 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 11, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 10, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 577 
uucgugcuga cuaugauaat t 21 
 
 
<210> 578 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 11, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 578 
uuaucauagu cagcacgaat t 21 
 
 
<210> 579 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 8, 9, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 10, 11, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 579 
augagaguua aagcaaacct t 21 
 
 
<210> 580 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 580 
gguuugcuuu aacucucaut t 21 
 
 
<210> 581 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 9, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 8, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 581 
guaguucaua aggagaguat t 21 
 
 
<210> 582 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 582 
uacucuccuu augaacuact t 21 
 
 
<210> 583 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 9, 10, 11, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 583 
aucgugucuu ucaugguaat t 21 
 
 
<210> 584 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 584 
uuaccaugaa agacacgaut t 21 
 
 
<210> 585 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 10, 11, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 12, 13, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 585 
aacaacuucu uaauguacat t 21 
 
 
<210> 586 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 586 
uguacauuaa gaaguuguut t 21 
 
 
<210> 587 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 10, 12, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 8, 9, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 587 
auaaucuggu auuagacuat t 21 
 
 
<210> 588 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 9, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 588 
uagucuaaua ccagauuaut t 21 
 
 
<210> 589 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 9, 10, 13, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 8, 11, 12, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 589 
uuugauagcc gaucaaagut t 21 
 
 
<210> 590 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 590 
acuuugaucg gcuaucaaat t 21 
 
 
<210> 591 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 8, 10, 11, 12, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 9, 13, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 591 
gguacuauau uugccuaugt t 21 
 
 
<210> 592 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 11, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 9, 10, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 592 
cauaggcaaa uauaguacct t 21 
 
 
<210> 593 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 9, 13, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 8, 10, 11, 12, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 593 
ugguuucaua aauuaucgat t 21 
 
 
<210> 594 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 594 
ucgauaauuu augaaaccat t 21 
 
 
<210> 595 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 9, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 10, 11, 12, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 595 
uaugcuauca aaagaacact t 21 
 
 
<210> 596 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 596 
guguucuuuu gauagcauat t 21 
 
 
<210> 597 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 9, 12, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 597 
ucuuuaccau caccucauct t 21 
 
 
<210> 598 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 598 
gaugagguga ugguaaagat t 21 
 
 
<210> 599 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 9, 14, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 599 
ggagaauaua agguugacut t 21 
 
 
<210> 600 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 600 
agucaaccuu auauucucct t 21 
 
 
<210> 601 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 10, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 9, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 601 
agcuuucaau gagaguuaat t 21 
 
 
<210> 602 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 602 
uuaacucuca uugaaagcut t 21 
 
 
<210> 603 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 9, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 8, 10, 11, 12, 13, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 603 
caugguaaug aaacuaccat t 21 
 
 
<210> 604 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 604 
ugguaguuuc auuaccaugt t 21 
 
 
<210> 605 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8, 11, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 9, 10, 12, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 605 
auggugauag caauaccuut t 21 
 
 
<210> 606 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 606 
aagguauugc uaucaccaut t 21 
 
 
<210> 607 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 8, 9, 11, 12, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 10, 13, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 607 
gcaccaauca ucgauucugt t 21 
 
 
<210> 608 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 608 
cagaaucgau gauuggugct t 21 
 
 
<210> 609 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 9, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 8, 10, 11, 12, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 609 
cuaauucaug aaauuucgat t 21 
 
 
<210> 610 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 610 
ucgaaauuuc augaauuagt t 21 
 
 
<210> 611 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 9, 10, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 611 
agagaguguu auagcagaat t 21 
 
 
<210> 612 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 9, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 612 
uucugcuaua acacucucut t 21 
 
 
<210> 613 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 9, 12, 13, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 10, 11, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 613 
uauguugcug aucucacagt t 21 
 
 
<210> 614 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 614 
cugugagauc agcaacauat t 21 
 
 
<210> 615 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 8, 13, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 9, 10, 11, 12, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 615 
auguuaauga gguaucaact t 21 
 
 
<210> 616 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 616 
guugauaccu cauuaacaut t 21 
 
 
<210> 617 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 9, 10, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 617 
cagcacuacu aaggauagat t 21 
 
 
<210> 618 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 618 
ucuauccuua guagugcugt t 21 
 
 
<210> 619 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 10, 11, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 12, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 619 
gacaagugau caagaaacut t 21 
 
 
<210> 620 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 620 
aguuucuuga ucacuuguct t 21 
 
 
<210> 621 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 11, 12, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 10, 13, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 621 
caauugaaga cugaccuaat t 21 
 
 
<210> 622 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 622 
uuaggucagu cuucaauugt t 21 
 
 
<210> 623 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 8, 9, 12, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 10, 11, 13, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 623 
gcaaaacuca guagacucct t 21 
 
 
<210> 624 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 624 
ggagucuacu gaguuuugct t 21 
 
 
<210> 625 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 10, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 9, 11, 12, 13, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 625 
uauagauggc aaaguuccat t 21 
 
 
<210> 626 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 626 
uggaacuuug ccaucuauat t 21 
 
 
<210> 627 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 8, 11, 12, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 9, 10, 13, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 627 
ugauagccga ucaaagucut t 21 
 
 
<210> 628 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 628 
agacuuugau cggcuaucat t 21 
 
 
<210> 629 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 11, 12, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9, 10, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 629 
agauagcaag uuaacacgat t 21 
 
 
<210> 630 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 630 
ucguguuaac uugcuaucut t 21 
 
 
<210> 631 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 9, 11, 12, 13, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 8, 10, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 631 
cuuacgugua ucuuacaugt t 21 
 
 
<210> 632 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 10, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 632 
cauguaagau acacguaagt t 21 
 
 
<210> 633 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 8, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 9, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 633 
ucgauucugc cauacaaggt t 21 
 
 
<210> 634 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 634 
ccuuguaugg cagaaucgat t 21 
 
 
<210> 635 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 8, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 9, 10, 11, 13, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 635 
gagugguuaa auacucguut t 21 
 
 
<210> 636 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 636 
aacgaguauu uaaccacuct t 21 
 
 
<210> 637 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 11, 12, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 637 
auagaaagug aguugaacut t 21 
 
 
<210> 638 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 638 
aguucaacuc acuuucuaut t 21 
 
 
<210> 639 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 9, 10, 11, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 639 
aaccacagag aaaauucgat t 21 
 
 
<210> 640 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 640 
ucgaauuuuc ucugugguut t 21 
 
 
<210> 641 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 10, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 8, 9, 11, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 641 
ucgagauagc aaguuaacat t 21 
 
 
<210> 642 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 642 
uguuaacuug cuaucucgat t 21 
 
 
<210> 643 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 12, 13, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 8, 9, 10, 11, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 643 
uggcucagaa acuuaaugat t 21 
 
 
<210> 644 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 644 
ucauuaaguu ucugagccat t 21 
 
 
<210> 645 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 11, 12, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 9, 10, 13, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 645 
ucaaggaagg cuguaauaut t 21 
 
 
<210> 646 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 646 
auauuacagc cuuccuugat t 21 
 
 
<210> 647 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 12, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 9, 10, 11, 13, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 647 
ucagagaugg augaucauut t 21 
 
 
<210> 648 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 648 
aaugaucauc caucucugat t 21 
 
 
<210> 649 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 11, 13, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 8, 9, 10, 12, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 649 
auuauaaaag cacugaucat t 21 
 
 
<210> 650 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 650 
ugaucagugc uuuuauaaut t 21 
 
 
<210> 651 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 9, 10, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 651 
ccagagaauu aagggaucut t 21 
 
 
<210> 652 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 652 
agaucccuua auucucuggt t 21 
 
 
<210> 653 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 9, 13, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 653 
cucauccagu ucgcuauuut t 21 
 
 
<210> 654 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 654 
aaauagcgaa cuggaugagt t 21 
 
 
<210> 655 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 8, 11, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 9, 10, 12, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 655 
caugacuuag cauauuccat t 21 
 
 
<210> 656 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 656 
uggaauaugc uaagucaugt t 21 
 
 
<210> 657 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 8, 10, 11, 12, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 9, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 657 
uuacguguau cuuacauggt t 21 
 
 
<210> 658 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 11, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 658 
ccauguaaga uacacguaat t 21 
 
 
<210> 659 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 9, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 659 
aacucaguag acuccucuut t 21 
 
 
<210> 660 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 660 
aagaggaguc uacugaguut t 21 
 
 
<210> 661 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 8, 9, 11, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 10, 12, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 661 
auuuugaucg ugucuuucat t 21 
 
 
<210> 662 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 662 
ugaaagacac gaucaaaaut t 21 
 
 
<210> 663 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 663 
cuaaaucagg agaauauagt t 21 
 
 
<210> 664 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 664 
cuauauucuc cugauuuagt t 21 
 
 
<210> 665 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 665 
gaaagaagug cuaccauaut t 21 
 
 
<210> 666 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 666 
auaugguagc acuucuuuct t 21 
 
 
<210> 667 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 9, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 13, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 667 
ugagauaaca aaacucacct t 21 
 
 
<210> 668 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 668 
ggugaguuuu guuaucucat t 21 
 
 
<210> 669 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 10, 11, 13, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 669 
ggcuacaaug guacuauaut t 21 
 
 
<210> 670 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 10, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 670 
auauaguacc auuguagcct t 21 
 
 
<210> 671 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 8, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 9, 10, 11, 12, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 671 
acaauuacga aaugcucuut t 21 
 
 
<210> 672 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 672 
aagagcauuu cguaauugut t 21 
 
 
<210> 673 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 11, 13, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 9, 10, 12, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 673 
ucaaaaguga uauucacgat t 21 
 
 
<210> 674 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 674 
ucgugaauau cacuuuugat t 21 
 
 
<210> 675 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 675 
auagauggca aaguuccaat t 21 
 
 
<210> 676 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 676 
uuggaacuuu gccaucuaut t 21 
 
 
<210> 677 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 9, 10, 11, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 12, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 677 
aagugauauu cacgauacut t 21 
 
 
<210> 678 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 678 
aguaucguga auaucacuut t 21 
 
 
<210> 679 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 9, 10, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 8, 11, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 679 
agcaccaauc aucgauucut t 21 
 
 
<210> 680 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 680 
agaaucgaug auuggugcut t 21 
 
 
<210> 681 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 13, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 681 
ggaauuucuc uuacguguat t 21 
 
 
<210> 682 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 682 
uacacguaag agaaauucct t 21 
 
 
<210> 683 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 8, 9, 12, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 10, 11, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 683 
aauuggccca acuuuuggat t 21 
 
 
<210> 684 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 684 
uccaaaaguu gggccaauut t 21 
 
 
<210> 685 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 10, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 8, 9, 11, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 685 
auacccaaac acuaacugct t 21 
 
 
<210> 686 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 686 
gcaguuagug uuuggguaut t 21 
 
 
<210> 687 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 8, 9, 12, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 10, 11, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 687 
uugauagccg aucaaaguct t 21 
 
 
<210> 688 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 688 
gacuuugauc ggcuaucaat t 21 
 
 
<210> 689 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 9, 11, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 8, 10, 12, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 689 
auaccuuaca cauucaauat t 21 
 
 
<210> 690 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 690 
uauugaaugu guaagguaut t 21 
 
 
<210> 691 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 10, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 9, 11, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 691 
gcuguaauau aaaucgaagt t 21 
 
 
<210> 692 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 11, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 692 
cuucgauuua uauuacagct t 21 
 
 
<210> 693 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 9, 10, 11, 12, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 8, 13, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 693 
uuuuaauacc uuacacauut t 21 
 
 
<210> 694 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 694 
aauguguaag guauuaaaat t 21 
 
 
<210> 695 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 9, 12, 13, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 10, 11, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 695 
acccagggca auucaugact t 21 
 
 
<210> 696 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 696 
gucaugaauu gcccugggut t 21 
 
 
<210> 697 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 8, 11, 12, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 9, 10, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 697 
uuuuugauag ccgaucaaat t 21 
 
 
<210> 698 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 698 
uuugaucggc uaucaaaaat t 21 
 
 
<210> 699 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 8, 9, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 10, 11, 12, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 699 
ucugguauua gacuaugaat t 21 
 
 
<210> 700 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 700 
uucauagucu aauaccagat t 21 
 
 
<210> 701 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 9, 10, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 11, 12, 13, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 701 
agguugacuc agauacuact t 21 
 
 
<210> 702 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 702 
guaguaucug agucaaccut t 21 
 
 
<210> 703 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 8, 9, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 10, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 703 
guugaacuca cuucgugcut t 21 
 
 
<210> 704 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 704 
agcacgaagu gaguucaact t 21 
 
 
<210> 705 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 9, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, 13, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 705 
agagaaauug aagcuacagt t 21 
 
 
<210> 706 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 706 
cuguagcuuc aauuucucut t 21 
 
 
<210> 707 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 8, 13, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 707 
cagguuaauc cuaccacact t 21 
 
 
<210> 708 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 708 
gugugguagg auuaaccugt t 21 
 
 
<210> 709 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 11, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 8, 9, 10, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 709 
gaacuugagg ugacuaaugt t 21 
 
 
<210> 710 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 8, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 710 
cauuagucac cucaaguuct t 21 
 
 
<210> 711 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 711 
uacguguauc uuacauggat t 21 
 
 
<210> 712 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 12, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 10, 11, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 712 
uccauguaag auacacguat t 21 
 
 
<210> 713 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 8, 9, 12, 13, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 10, 11, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 713 
uauaagguug acucagauat t 21 
 
 
<210> 714 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 714 
uaucugaguc aaccuuauat t 21 
 
 
<210> 715 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 9, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 10, 11, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 715 
acuauaacua gagaccuagt t 21 
 
 
<210> 716 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 10, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 716 
cuaggucucu aguuauagut t 21 
 
 
<210> 717 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10, 12, 13, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 11, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 717 
caaaagugau auucacgaut t 21 
 
 
<210> 718 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 718 
aucgugaaua ucacuuuugt t 21 
 
 
<210> 719 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 11, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 719 
acggagaaua uaagguugat t 21 
 
 
<210> 720 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 8, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 720 
ucaaccuuau auucuccgut t 21 
 
 
<210> 721 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 10, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 8, 9, 11, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 721 
augacuuagc auauuccaat t 21 
 
 
<210> 722 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 722 
uuggaauaug cuaagucaut t 21 
 
 
<210> 723 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 9, 12, 13, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 10, 11, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 723 
agcagcacca aucaucgaut t 21 
 
 
<210> 724 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 724 
aucgaugauu ggugcugcut t 21 
 
 
<210> 725 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 10, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 8, 9, 11, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 725 
agcugucaau gagacucagt t 21 
 
 
<210> 726 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 726 
cugagucuca uugacagcut t 21 
 
 
<210> 727 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 9, 10, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 8, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 727 
auaaauuauc gagauagcat t 21 
 
 
<210> 728 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 728 
ugcuaucucg auaauuuaut t 21 
 
 
<210> 729 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 8, 9, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 729 
agcacuacua aggauagaat t 21 
 
 
<210> 730 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 730 
uucuauccuu aguagugcut t 21 
 
 
<210> 731 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 9, 11, 12, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 10, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 731 
ugguuaaaua cucguuuugt t 21 
 
 
<210> 732 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 732 
caaaacgagu auuuaaccat t 21 
 
 
<210> 733 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 11, 13, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 8, 9, 10, 12, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 733 
aauacccaaa cacuaacugt t 21 
 
 
<210> 734 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 734 
caguuagugu uuggguauut t 21 
 
 
<210> 735 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 8, 9, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 10, 11, 12, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 735 
uugcaaauug agagggacct t 21 
 
 
<210> 736 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 736 
ggucccucuc aauuugcaat t 21 
 
 
<210> 737 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 10, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 7, 8, 9, 11, 12, 13, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 737 
ugugugaaau agaacacuut t 21 
 
 
<210> 738 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 738 
aaguguucua uuucacacat t 21 
 
 
<210> 739 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 8, 9, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 10, 11, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 739 
acaggaauua aaggcuaaat t 21 
 
 
<210> 740 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 740 
uuuagccuuu aauuccugut t 21 
 
 
<210> 741 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 8, 9, 11, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 10, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 741 
uggccgucug cgugcgagut t 21 
 
 
<210> 742 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 742 
acucgcacgc agacggccat t 21 
 
 
<210> 743 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 8, 10, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 9, 11, 12, 13, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 743 
gucugcgugc gagugcggct t 21 
 
 
<210> 744 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 744 
gccgcacucg cacgcagact t 21 
 
 
<210> 745 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 11, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 8, 9, 10, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 745 
gguuacuaag ugauggacat t 21 
 
 
<210> 746 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 746 
uguccaucac uuaguaacct t 21 
 
 
<210> 747 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 10, 11, 12, 13, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 8, 9, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 747 
uucaugaaau uucgaacuut t 21 
 
 
<210> 748 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 748 
aaguucgaaa uuucaugaat t 21 
 
 
<210> 749 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 10, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 749 
gucguucuca uaccaucuut t 21 
 
 
<210> 750 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 750 
aagaugguau gagaacgact t 21 
 
 
<210> 751 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 8, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 751 
gcacuacuaa ggauagaaat t 21 
 
 
<210> 752 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 752 
uuucuauccu uaguagugct t 21 
 
 
<210> 753 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 9, 11, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 8, 10, 12, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 753 
cucuuacgug uaucuuacat t 21 
 
 
<210> 754 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8, 10, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 754 
uguaagauac acguaagagt t 21 
 
 
<210> 755 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 755 
aacucaccuc ccuuauagat t 21 
 
 
<210> 756 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 756 
ucuauaaggg aggugaguut t 21 
 
 
<210> 757 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 12, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 757 
gagauagcaa guuaacacgt t 21 
 
 
<210> 758 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 758 
cguguuaacu ugcuaucuct t 21 
 
 
<210> 759 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 8, 9, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 759 
ccuuaacuug uggagguggt t 21 
 
 
<210> 760 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 8, 10, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 760 
ccaccuccac aaguuaaggt t 21 
 
 
<210> 761 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 761 
aaaguaagau gcucgaguut t 21 
 
 
<210> 762 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 762 
aacucgagca ucuuacuuut t 21 
 
 
<210> 763 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 8, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 9, 10, 11, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 763 
uaauucauga aauuucgaat t 21 
 
 
<210> 764 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 764 
uucgaaauuu caugaauuat t 21 
 
 
<210> 765 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 8, 9, 10, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 11, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 765 
aguugaacuc acuucgugct t 21 
 
 
<210> 766 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 766 
gcacgaagug aguucaacut t 21 
 
 
<210> 767 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8, 13, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 9, 10, 11, 12, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 767 
augguaauga aacuaccaat t 21 
 
 
<210> 768 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 768 
uugguaguuu cauuaccaut t 21 
 
 
<210> 769 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 8, 13, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 769 
ugaacucacu ucgugcugat t 21 
 
 
<210> 770 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 770 
ucagcacgaa gugaguucat t 21 
 
 
<210> 771 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 11, 12, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 8, 10, 13, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 771 
ucacuucgug cugacuaugt t 21 
 
 
<210> 772 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 772 
cauagucagc acgaagugat t 21 
 
 
<210> 773 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 8, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 9, 10, 11, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 773 
uggugcccag guuaauccut t 21 
 
 
<210> 774 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 774 
aggauuaacc ugggcaccat t 21 
 
 
<210> 775 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 9, 11, 12, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 10, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 775 
ggcagcggca uuguacaaat t 21 
 
 
<210> 776 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 776 
uuuguacaau gccgcugcct t 21 
 
 
<210> 777 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 9, 10, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 777 
agguuucuuu agagacgcgt t 21 
 
 
<210> 778 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 778 
cgcgucucua aagaaaccut t 21 
 
 
<210> 779 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 8, 12, 13, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 9, 10, 11, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 779 
gguuucauaa auuaucgagt t 21 
 
 
<210> 780 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 780 
cucgauaauu uaugaaacct t 21 
 
 
<210> 781 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 11, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 8, 9, 10, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 781 
auucaugaaa uuucgaacut t 21 
 
 
<210> 782 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 782 
aguucgaaau uucaugaaut t 21 
 
 
<210> 783 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 783 
aacaauuaga ggagguuuct t 21 
 
 
<210> 784 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 784 
gaaaccuccu cuaauuguut t 21 
 
 
<210> 785 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 9, 11, 12, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 10, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 785 
agugcggccg cugaacagct t 21 
 
 
<210> 786 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 786 
gcuguucagc ggccgcacut t 21 
 
 
<210> 787 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 11, 12, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 8, 9, 10, 13, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 787 
ggugcccagg uuaauccuat t 21 
 
 
<210> 788 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 788 
uaggauuaac cugggcacct t 21 
 
 
<210> 789 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 789 
agaaaguaag augcucgagt t 21 
 
 
<210> 790 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 790 
cucgagcauc uuacuuucut t 21 
 
 
<210> 791 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 791 
aaacucaccu cccuuauagt t 21 
 
 
<210> 792 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 792 
cuauaaggga ggugaguuut t 21 
 
 
<210> 793 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 9, 11, 12, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 10, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 793 
aaguaagaug cucgaguugt t 21 
 
 
<210> 794 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 794 
caacucgagc aucuuacuut t 21 
 
 
<210> 795 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 13, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 795 
ccuuaaggga aaugauagct t 21 
 
 
<210> 796 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 796 
gcuaucauuu cccuuaaggt t 21 
 
 
<210> 797 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 8, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 9, 10, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 797 
cccagguuaa uccuaccact t 21 
 
 
<210> 798 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 798 
gugguaggau uaaccugggt t 21 
 
 
<210> 799 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 8, 9, 10, 12, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 11, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 799 
guggccgucu gcgugcgagt t 21 
 
 
<210> 800 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 800 
cucgcacgca gacggccact t 21 
 
 
<210> 801 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 801 
aaucuaagaa gaguagaggt t 21 
 
 
<210> 802 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 802 
ccucuacucu ucuuagauut t 21 
 
 
<210> 803 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 9, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 10, 11, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 803 
cuggugccca gguuaaucct t 21 
 
 
<210> 804 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 804 
ggauuaaccu gggcaccagt t 21 
 
 
<210> 805 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 9, 11, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 10, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 805 
agaauaauug ccauaaugat t 21 
 
 
<210> 806 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 10, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 806 
ucauuauggc aauuauucut t 21 
 
 
<210> 807 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 8, 9, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 10, 11, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 807 
uucaauuuug aucgugucut t 21 
 
 
<210> 808 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 808 
agacacgauc aaaauugaat t 21 
 
 
<210> 809 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 8, 9, 11, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 10, 12, 13, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 809 
uacaaggcua caaugguact t 21 
 
 
<210> 810 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 10, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 810 
guaccauugu agccuuguat t 21 
 
 
<210> 811 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 8, 9, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 10, 11, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 811 
gcccagguua auccuaccat t 21 
 
 
<210> 812 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 812 
ugguaggauu aaccugggct t 21 
 
 
<210> 813 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 10, 11, 12, 13, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 9, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 813 
uugaacucac uucgugcugt t 21 
 
 
<210> 814 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 814 
cagcacgaag ugaguucaat t 21 
 
 
<210> 815 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 8, 9, 10, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 11, 12, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 815 
caauuggccc aacuuuuggt t 21 
 
 
<210> 816 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 816 
ccaaaaguug ggccaauugt t 21 
 
 
<210> 817 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 8, 9, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 10, 13, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 817 
aauggacuug ucauacucat t 21 
 
 
<210> 818 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 818 
ugaguaugac aaguccauut t 21 
 
 
<210> 819 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 8, 10, 11, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 9, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 819 
cauaaauuau cgagauagct t 21 
 
 
<210> 820 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 820 
gcuaucucga uaauuuaugt t 21 
 
 
<210> 821 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 11, 12, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 8, 9, 10, 13, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 821 
gagcuaaaaa uuguucacat t 21 
 
 
<210> 822 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 822 
ugugaacaau uuuuagcuct t 21 
 
 
<210> 823 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 8, 10, 12, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 9, 11, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 823 
aauaccuuac acauucaaut t 21 
 
 
<210> 824 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 824 
auugaaugug uaagguauut t 21 
 
 
<210> 825 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 9, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 10, 11, 12, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 825 
agggaucuca aauugaacct t 21 
 
 
<210> 826 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 826 
gguucaauuu gagaucccut t 21 
 
 
<210> 827 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 8, 9, 10, 11, 12, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 13, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 827 
agccaggucc uuggcacgct t 21 
 
 
<210> 828 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 828 
gcgugccaag gaccuggcut t 21 
 
 
<210> 829 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 11, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 10, 12, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 829 
agaauccuca uguuacauct t 21 
 
 
<210> 830 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 830 
gauguaacau gaggauucut t 21 
 
 
<210> 831 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 9, 12, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 10, 11, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 831 
auaacuucca guugacuaat t 21 
 
 
<210> 832 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 832 
uuagucaacu ggaaguuaut t 21 
 
 
<210> 833 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 9, 10, 11, 13, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 12, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 833 
gaauuucucu uacguguaut t 21 
 
 
<210> 834 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 834 
auacacguaa gagaaauuct t 21 
 
 
<210> 835 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 9, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 835 
aaccucucac uucccuauut t 21 
 
 
<210> 836 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 836 
aauagggaag ugagagguut t 21 
 
 
<210> 837 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 8, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 9, 10, 11, 12, 13, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 837 
uggaagcuaa aaauacccat t 21 
 
 
<210> 838 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 838 
uggguauuuu uagcuuccat t 21 
 
 
<210> 839 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 10, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 9, 11, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 839 
cucacuucgu gcugacuaut t 21 
 
 
<210> 840 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 840 
auagucagca cgaagugagt t 21 
 
 
<210> 841 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 9, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 10, 11, 12, 14, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 841 
agagugguua aauacucgut t 21 
 
 
<210> 842 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 842 
acgaguauuu aaccacucut t 21 
 
 
<210> 843 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 13, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 8, 9, 10, 11, 12, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 843 
gauacucaag aacaauuact t 21 
 
 
<210> 844 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 844 
guaauuguuc uugaguauct t 21 
 
 
<210> 845 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 11, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 10, 12, 13, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 845 
cuuauguuaa ugagguauct t 21 
 
 
<210> 846 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8, 11, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 10, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 846 
gauaccucau uaacauaagt t 21 
 
 
<210> 847 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 8, 10, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 9, 11, 12, 13, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 847 
augucaauau gagucauaat t 21 
 
 
<210> 848 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 848 
uuaugacuca uauugacaut t 21 
 
 
<210> 849 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7, 8, 11, 12, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 9, 10, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 849 
aaaacacuga uuacugagat t 21 
 
 
<210> 850 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 850 
ucucaguaau caguguuuut t 21 
 
 
<210> 851 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 9, 10, 11, 12, 13, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 8, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 851 
agcagucguu cucauaccat t 21 
 
 
<210> 852 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 852 
ugguaugaga acgacugcut t 21 
 
 
<210> 853 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 11, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 10, 12, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 853 
gauaaucugg uauuagacut t 21 
 
 
<210> 854 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 854 
agucuaauac cagauuauct t 21 
 
 
<210> 855 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 8, 12, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 9, 10, 11, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 855 
uguaauauaa aucgaagcut t 21 
 
 
<210> 856 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 856 
agcuucgauu uauauuacat t 21 
 
 
<210> 857 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 9, 10, 12, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 11, 13, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 857 
agugauauuc acgauacugt t 21 
 
 
<210> 858 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 858 
caguaucgug aauaucacut t 21 
 
 
<210> 859 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 12, 13, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 8, 9, 10, 11, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 859 
aauucaugaa auuucgaact t 21 
 
 
<210> 860 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 860 
guucgaaauu ucaugaauut t 21 
 
 
<210> 861 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 10, 12, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 8, 9, 11, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 861 
aggcuguaau auaaaucgat t 21 
 
 
<210> 862 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 9, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 862 
ucgauuuaua uuacagccut t 21 
 
 
<210> 863 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 9, 10, 11, 13, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 12, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 863 
agguuaaucc uaccacacat t 21 
 
 
<210> 864 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 864 
ugugugguag gauuaaccut t 21 
 
 
<210> 865 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 9, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 10, 11, 12, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 865 
ggaucuguua agguauccct t 21 
 
 
<210> 866 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 866 
gggauaccuu aacagaucct t 21 
 
 
<210> 867 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 12, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 8, 9, 10, 11, 13, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 867 
caauuacgaa augcucuugt t 21 
 
 
<210> 868 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 868 
caagagcauu ucguaauugt t 21 
 
 
<210> 869 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 9, 11, 12, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 10, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 869 
aaaagugaua uucacgauat t 21 
 
 
<210> 870 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 870 
uaucgugaau aucacuuuut t 21 
 
 
<210> 871 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 9, 10, 12, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 11, 13, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 871 
gagcuuucuu acaagaccct t 21 
 
 
<210> 872 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 872 
gggucuugua agaaagcuct t 21 
 
 
<210> 873 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 9, 11, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 8, 10, 12, 13, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 873 
gaugucaaua ugagucauat t 21 
 
 
<210> 874 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 8, 10, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 874 
uaugacucau auugacauct t 21 
 
 
<210> 875 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 9, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 10, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 875 
gaagcagucg uucucauact t 21 
 
 
<210> 876 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 876 
guaugagaac gacugcuuct t 21 
 
 
<210> 877 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 9, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 877 
acguguaucu uacauggaat t 21 
 
 
<210> 878 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 8, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 878 
uuccauguaa gauacacgut t 21 
 
 
<210> 879 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 9, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 879 
acguguaucu uacauggaat t 21 
 
 
<210> 880 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 8, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 880 
uuccauguaa gauacacgut t 21 
 
 
<210> 881 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 9, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 881 
acguguaucu uacauggaat t 21 
 
 
<210> 882 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 8, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 882 
uuccauguaa gauacacgut t 21 
 
 
<210> 883 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 9, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 883 
acguguaucu uacauggaat t 21 
 
 
<210> 884 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 8, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 884 
uuccauguaa gauacacgut t 21 
 
 
<210> 885 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 9, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 885 
acguguaucu uacauggaat t 21 
 
 
<210> 886 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 8, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 886 
uuccauguaa gauacacgut t 21 
 
 
<210> 887 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 11, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 10, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 887 
ggcuguaaua uaaaucgaat t 21 
 
 
<210> 888 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 8, 10, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 888 
uucgauuuau auuacagcct t 21 
 
 
<210> 889 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 11, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 10, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 889 
ggcuguaaua uaaaucgaat t 21 
 
 
<210> 890 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 8, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 9, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 890 
uucgauuuau auuacagcct t 21 
 
 
<210> 891 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 11, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 10, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 891 
ggcuguaaua uaaaucgaat t 21 
 
 
<210> 892 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 8, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 9, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 892 
uucgauuuau auuacagcct t 21 
 
 
<210> 893 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 9, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 893 
auagcaaguu aacacgaaut t 21 
 
 
<210> 894 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 9, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 894 
auucguguua acuugcuaut t 21 
 
 
<210> 895 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 9, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 895 
auagcaaguu aacacgaaut t 21 
 
 
<210> 896 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 2, 3, 9, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 896 
auucguguua acuugcuaut t 21 
 
 
<210> 897 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 9, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 897 
auagcaaguu aacacgaaut t 21 
 
 
<210> 898 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 2, 3, 9, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 898 
auucguguua acuugcuaut t 21 
 
 
<210> 899 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 9, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 899 
auagcaaguu aacacgaaut t 21 
 
 
<210> 900 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 9, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 900 
auucguguua acuugcuaut t 21 
 
 
<210> 901 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 9, 10, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 11, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 901 
auagcaaguu aacacgaaut t 21 
 
 
<210> 902 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 9, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 902 
auucguguua acuugcuaut t 21 
 
 
<210> 903 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 11, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 903 
ugcugaaacu guagcccuut t 21 
 
 
<210> 904 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 7, 9, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 904 
aagggcuaca guuucagcat t 21 
 
 
<210> 905 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 11, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 905 
ugcugaaacu guagcccuut t 21 
 
 
<210> 906 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 7, 9, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 906 
aagggcuaca guuucagcat t 21 
 
 
<210> 907 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 11, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 907 
ugcugaaacu guagcccuut t 21 
 
 
<210> 908 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 7, 9, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 908 
aagggcuaca guuucagcat t 21 
 
 
<210> 909 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 11, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 909 
ugcugaaacu guagcccuut t 21 
 
 
<210> 910 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 7, 9, 12, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 910 
aagggcuaca guuucagcat t 21 
 
 
<210> 911 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 11, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 911 
ugcugaaacu guagcccuut t 21 
 
 
<210> 912 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 7, 9, 12, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 912 
aagggcuaca guuucagcat t 21 
 
 
<210> 913 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 913 
ucauaaggag aguagaguut t 21 
 
 
<210> 914 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 914 
aacucuacuc uccuuaugat t 21 
 
 
<210> 915 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 915 
ucauaaggag aguagaguut t 21 
 
 
<210> 916 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 6, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 916 
aacucuacuc uccuuaugat t 21 
 
 
<210> 917 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 917 
ucauaaggag aguagaguut t 21 
 
 
<210> 918 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 6, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 918 
aacucuacuc uccuuaugat t 21 
 
 
<210> 919 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 10, 11, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 12, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 919 
cuuugaagac cgagcuuuct t 21 
 
 
<210> 920 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 920 
gaaagcucgg ucuucaaagt t 21 
 
 
<210> 921 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 10, 11, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 12, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 921 
cuuugaagac cgagcuuuct t 21 
 
 
<210> 922 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 922 
gaaagcucgg ucuucaaagt t 21 
 
 
<210> 923 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 10, 11, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 12, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 923 
cuuugaagac cgagcuuuct t 21 
 
 
<210> 924 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 924 
gaaagcucgg ucuucaaagt t 21 
 
 
<210> 925 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 10, 12, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 9, 11, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 925 
guuagagagu guuauagcat t 21 
 
 
<210> 926 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 926 
ugcuauaaca cucucuaact t 21 
 
 
<210> 927 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 10, 12, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 9, 11, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 927 
guuagagagu guuauagcat t 21 
 
 
<210> 928 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 9, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 928 
ugcuauaaca cucucuaact t 21 
 
 
<210> 929 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 10, 12, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 9, 11, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 929 
guuagagagu guuauagcat t 21 
 
 
<210> 930 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 9, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 930 
ugcuauaaca cucucuaact t 21 
 
 
<210> 931 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10, 11, 12, 13, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 931 
caagaacagu ccuuaaauat t 21 
 
 
<210> 932 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 932 
uauuuaagga cuguucuugt t 21 
 
 
<210> 933 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10, 11, 12, 13, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 933 
caagaacagu ccuuaaauat t 21 
 
 
<210> 934 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 934 
uauuuaagga cuguucuugt t 21 
 
 
<210> 935 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 7, 10, 11, 12, 13, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 935 
caagaacagu ccuuaaauat t 21 
 
 
<210> 936 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 936 
uauuuaagga cuguucuugt t 21 
 
 
<210> 937 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 12, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 937 
ccuuagagaa acuauaacut t 21 
 
 
<210> 938 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 4, 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 938 
aguuauaguu ucucuaaggt t 21 
 
 
<210> 939 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 12, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 939 
ccuuagagaa acuauaacut t 21 
 
 
<210> 940 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 10, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 940 
aguuauaguu ucucuaaggt t 21 
 
 
<210> 941 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 12, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 941 
ccuuagagaa acuauaacut t 21 
 
 
<210> 942 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 10, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 942 
aguuauaguu ucucuaaggt t 21 
 
 
<210> 943 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 9, 10, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 11, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 943 
augagugcuu gaauagauut t 21 
 
 
<210> 944 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 5, 9, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 944 
aaucuauuca agcacucaut t 21 
 
 
<210> 945 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 9, 10, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 11, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 945 
augagugcuu gaauagauut t 21 
 
 
<210> 946 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 5, 9, 13, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 10, 11, 12, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 946 
aaucuauuca agcacucaut t 21 
 
 
<210> 947 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 9, 10, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 11, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 947 
augagugcuu gaauagauut t 21 
 
 
<210> 948 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 5, 9, 13, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 10, 11, 12, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 948 
aaucuauuca agcacucaut t 21 
 
 
<210> 949 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 949 
caaugcaagg aacggaauut t 21 
 
 
<210> 950 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 950 
aauuccguuc cuugcauugt t 21 
 
 
<210> 951 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 951 
caaugcaagg aacggaauut t 21 
 
 
<210> 952 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 952 
aauuccguuc cuugcauugt t 21 
 
 
<210> 953 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 953 
caaugcaagg aacggaauut t 21 
 
 
<210> 954 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 3, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 954 
aauuccguuc cuugcauugt t 21 
 
 
<210> 955 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 9, 12, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 7, 8, 10, 11, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 955 
uuuuuugaua gccgaucaat t 21 
 
 
<210> 956 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 956 
uugaucggcu aucaaaaaat t 21 
 
 
<210> 957 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 9, 12, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 7, 8, 10, 11, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 957 
uuuuuugaua gccgaucaat t 21 
 
 
<210> 958 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 958 
uugaucggcu aucaaaaaat t 21 
 
 
<210> 959 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 9, 12, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 7, 8, 10, 11, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 959 
uuuuuugaua gccgaucaat t 21 
 
 
<210> 960 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 2, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 960 
uugaucggcu aucaaaaaat t 21 
 
 
<210> 961 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 11, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 14, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 961 
uagauugucu cuugacuugt t 21 
 
 
<210> 962 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 6, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 962 
caagucaaga gacaaucuat t 21 
 
 
<210> 963 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 9, 10, 11, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 14, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 963 
uagauugucu cuugacuugt t 21 
 
 
<210> 964 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1, 6, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 964 
caagucaaga gacaaucuat t 21 
 
 
<210> 965 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA targeting KIF11 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 11, 12, 13, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 965 
tcgagaatct aaactaactt t 21 
 
 
<210> 966 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA targeting KIF11 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 10, 11, 12, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 966 
agttagttta gattctcgat t 21 
 
 
<210> 967 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: sense strand of dsRNA targeting luciferase 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 10, 11, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 967 
cttacgctga gtacttcgat t 21 
 
 
<210> 968 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: antisense strand of dsRNA targeting luciferase 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 968 
tcgaagtact cagcgtaagt t 21 
 
 
<210> 969 
<211> 8630 
<212> DNA 
<213> Homo sapiens 
  
<220>   
<223> cDNA sequence of human KIF10 
  
<300>
<308> NM_001813.2
<309> 2009-10-18
  
<400> 969 
taaatttaaaggcggggcggcctgtgagccctgaagtgccggccgcggagggtcctggcc 60 
attttcctgggaccagttcagcctgataggatggcggaggaaggagccgtggccgtctgc 120 
gtgcgagtgcggccgctgaacagcagagaagaatcacttggagaaactgcccaagtttac 180 
tggaaaactgacaataatgtcatttatcaagttgatggaagtaaatccttcaattttgat 240 
cgtgtctttcatggtaatgaaactaccaaaaatgtgtatgaagaaatagcagcaccaatc 300 
atcgattctgccatacaaggctacaatggtactatatttgcctatggacagactgcttca 360 
ggaaaaacatataccatgatgggttcagaagatcatttgggagttatacccagggcaatt 420 
catgacattttccaaaaaattaagaagtttcctgatagggaatttctcttacgtgtatct 480 
tacatggaaatatacaatgaaaccattacagatttactctgtggcactcaaaaaatgaaa 540 
cctttaattattcgagaagatgtcaataggaatgtgtatgttgctgatctcacagaagaa 600 
gttgtatatacatcagaaatggctttgaaatggattacaaagggagaaaagagcaggcat 660 
tatggagaaacaaaaatgaatcaaagaagcagtcgttctcataccatctttaggatgatt 720 
ttggaaagcagagagaagggtgaaccttctaattgtgaaggatctgttaaggtatcccat 780 
ttgaatttggttgatcttgcaggcagtgaaagagctgctcaaacaggcgctgcaggtgtg 840 
cggctcaaggaaggctgtaatataaatcgaagcttatttattttgggacaagtgatcaag 900 
aaacttagtgatggacaagttggtggtttcataaattatcgagatagcaagttaacacga 960 
attctccagaattccttgggaggaaatgcaaagacacgtattatctgcacaattactcca 1020 
gtatcttttgatgaaacacttactgctctccagtttgccagtactgctaaatatatgaag 1080 
aatactccttatgttaatgaggtatcaactgatgaagctctcctgaaaaggtatagaaaa 1140 
gaaataatggatcttaaaaaacaattagaggaggtttctttagagacgcgggctcaggca 1200 
atggaaaaagaccaattggcccaacttttggaagaaaaagatttgcttcagaaagtacag 1260 
aatgagaaaattgaaaacttaacacggatgctggtgacctcttcttccctcacgttgcaa 1320 
caggaattaaaggctaaaagaaaacgaagagttacttggtgccttggcaaaattaacaaa 1380 
atgaagaactcaaactatgcagatcaatttaatataccaacaaatataacaacaaaaaca 1440 
cataagctttctataaatttattacgagaaattgatgaatctgtctgttcagagtctgat 1500 
gttttcagtaacactcttgatacattaagtgagatagaatggaatccagcaacaaagcta 1560 
ctaaatcaggagaatatagaaagtgagttgaactcacttcgtgctgactatgataatctg 1620 
gtattagactatgaacaactacgaacagaaaaagaagaaatggaattgaaattaaaagaa 1680 
aagaatgatttggatgaatttgaggctctagaaagaaaaactaaaaaagatcaagagatg 1740 
caactaattcatgaaatttcgaacttaaagaatttagttaagcatgcagaagtatataat 1800 
caagatcttgagaatgaactcagttcaaaagtagagctgcttagagaaaaggaagaccag 1860 
attaagaagctacaggaatacatagactctcaaaagctagaaaatataaaaatggacttg 1920 
tcatactcattggaaagcattgaagacccaaaacaaatgaagcagactctgtttgatgct 1980 
gaaactgtagcccttgatgccaagagagaatcagcctttcttagaagtgaaaatctggag 2040 
ctgaaggagaaaatgaaagaacttgcaactacatacaagcaaatggaaaatgatattcag 2100 
ttatatcaaagccagttggaggcaaaaaagaaaatgcaagttgatctggagaaagaatta 2160 
caatctgcttttaatgagataacaaaactcacctcccttatagatggcaaagttccaaaa 2220 
gatttgctctgtaatttggaattggaaggaaagattactgatcttcagaaagaactaaat 2280 
aaagaagttgaagaaaatgaagctttgcgggaagaagtcattttgctttcagaattgaaa 2340 
tctttaccttctgaagtagaaaggctgaggaaagagatacaagacaaatctgaagagctc 2400 
catataataacatcagaaaaagataaattgttttctgaagtagttcataaggagagtaga 2460 
gttcaaggtttacttgaagaaattgggaaaacaaaagatgacctagcaactacacagtcg 2520 
aattataaaagcactgatcaagaattccaaaatttcaaaacccttcatatggactttgag 2580 
caaaagtataagatggtccttgaggagaatgagagaatgaatcaggaaatagttaatctc 2640 
tctaaagaagcccaaaaatttgattcgagtttgggtgctttgaagaccgagctttcttac 2700 
aagacccaagaacttcaggagaaaacacgtgaggttcaagaaagactaaatgagatggaa 2760 
cagctgaaggaacaattagaaaatagagattctacgctgcaaactgtagaaagggagaaa 2820 
acactgattactgagaaactgcagcaaactttagaagaagtaaaaactttaactcaagaa 2880 
aaagatgatctaaaacaactccaagaaagcttgcaaattgagagggaccaactcaaaagt 2940 
gatattcacgatactgttaacatgaatatagatactcaagaacaattacgaaatgctctt 3000 
gagtctctgaaacaacatcaagaaacaattaatacactaaaatcgaaaatttctgaggaa 3060 
gtttccaggaatttgcatatggaggaaaatacaggagaaactaaagatgaatttcagcaa 3120 
aagatggttggcatagataaaaaacaggatttggaagctaaaaatacccaaacactaact 3180 
gcagatgttaaggataatgagataattgagcaacaaaggaagatattttctttaatacag 3240 
gagaaaaatgaactccaacaaatgttagagagtgttatagcagaaaaggaacaattgaag 3300 
actgacctaaaggaaaatattgaaatgaccattgaaaaccaggaagaattaagacttctt 3360 
ggggatgaacttaaaaagcaacaagagatagttgcacaagaaaagaaccatgccataaag 3420 
aaagaaggagagctttctaggacctgtgacagactggcagaagttgaagaaaaactaaag 3480 
gaaaagagccagcaactccaagaaaaacagcaacaacttcttaatgtacaagaagagatg 3540 
agtgagatgcagaaaaagattaatgaaatagagaatttaaagaatgaattaaagaacaaa 3600 
gaattgacattggaacatatggaaacagagaggcttgagttggctcagaaacttaatgaa 3660 
aattatgaggaagtgaaatctataaccaaagaaagaaaagttctaaaggaattacagaag 3720 
tcatttgaaacagagagagaccaccttagaggatatataagagaaattgaagctacaggc 3780 
ctacaaaccaaagaagaactaaaaattgctcatattcacctaaaagaacaccaagaaact 3840 
attgatgaactaagaagaagcgtatctgagaagacagctcaaataataaatactcaggac 3900 
ttagaaaaatcccataccaaattacaagaagagatcccagtgcttcatgaggaacaagag 3960 
ttactgcctaatgtgaaagaagtcagtgagactcaggaaacaatgaatgaactggagtta 4020 
ttaacagaacagtccacaaccaaggactcaacaacactggcaagaatagaaatggaaagg 4080 
ctcaggttgaatgaaaaatttcaagaaagtcaggaagagataaaatctctaaccaaggaa 4140 
agagacaaccttaaaacgataaaagaagcccttgaagttaaacatgaccagctgaaagaa 4200 
catattagagaaactttggctaaaatccaggagtctcaaagcaaacaagaacagtcctta 4260 
aatatgaaagaaaaagacaatgaaactaccaaaatcgtgagtgagatggagcaattcaaa 4320 
cccaaagattcagcactactaaggatagaaatagaaatgctcggattgtccaaaagactt 4380 
caagaaagtcatgatgaaatgaaatctgtagctaaggagaaagatgacctacagaggctg 4440 
caagaagttcttcaatctgaaagtgaccagctcaaagaaaacataaaagaaattgtagct 4500 
aaacacctggaaactgaagaggaacttaaagttgctcattgttgcctgaaagaacaagag 4560 
gaaactattaatgagttaagagtgaatctttcagagaaggaaactgaaatatcaaccatt 4620 
caaaagcagttagaagcaatcaatgataaattacagaacaagatccaagagatttatgag 4680 
aaagaggaacaatttaatataaaacaaattagtgaggttcaggaaaaagtgaatgaactg 4740 
aaacaattcaaggagcatcgcaaagccaaggattcagcactacaaagtatagaaagtaag 4800 
atgctcgagttgaccaacagacttcaagaaagtcaagaagaaatacaaattatgattaag 4860 
gaaaaagaggaaatgaaaagagtacaggaggcccttcagatagagagagaccaactgaaa 4920 
gaaaacactaaagaaattgtagctaaaatgaaagaatctcaagaaaaagaatatcagttt 4980 
cttaagatgacagctgtcaatgagactcaggagaaaatgtgtgaaatagaacacttgaag 5040 
gagcaatttgagacccagaagttaaacctggaaaacatagaaacggagaatataaggttg 5100 
actcagatactacatgaaaaccttgaagaaatgagatctgtaacaaaagaaagagatgac 5160 
cttaggagtgtggaggagactctcaaagtagagagagaccagctcaaggaaaaccttaga 5220 
gaaactataactagagacctagaaaaacaagaggagctaaaaattgttcacatgcatctg 5280 
aaggagcaccaagaaactattgataaactaagagggattgtttcagagaaaacaaatgaa 5340 
atatcaaatatgcaaaaggacttagaacactcaaatgatgccttaaaagcacaggatctg 5400 
aaaatacaagaggaactaagaattgctcacatgcatctgaaagagcagcaggaaactatt 5460 
gacaaactcagaggaattgtttctgagaagacagataaactatcaaatatgcaaaaagat 5520 
ttagaaaattcaaatgctaaattacaagaaaagattcaagaacttaaggcaaatgaacat 5580 
caacttattacgttaaaaaaagatgtcaatgagacacagaaaaaagtgtctgaaatggag 5640 
caactaaagaaacaaataaaagaccaaagcttaactctgagtaaattagaaatagagaat 5700 
ttaaatttggctcagaaacttcatgaaaaccttgaagaaatgaaatctgtaatgaaagaa 5760 
agagataatctaagaagagtagaggagacactcaaactggagagagaccaactcaaggaa 5820 
agcctgcaagaaaccaaagctagagatctggaaatacaacaggaactaaaaactgctcgt 5880 
atgctatcaaaagaacacaaagaaactgttgataaacttagagaaaaaatttcagaaaag 5940 
acaattcaaatttcagacattcaaaaggatttagataaatcaaaagatgaattacagaaa 6000 
aagatccaagaacttcagaaaaaagaacttcaactgcttagagtgaaagaagatgtcaat 6060 
atgagtcataaaaaaattaatgaaatggaacagttgaagaagcaatttgaggcccaaaac 6120 
ttatctatgcaaagtgtgagaatggataacttccagttgactaagaaacttcatgaaagc 6180 
cttgaagaaataagaattgtagctaaagaaagagatgagctaaggaggataaaagaatct 6240 
ctcaaaatggaaagggaccaattcatagcaaccttaagggaaatgatagctagagaccga 6300 
cagaaccaccaagtaaaacctgaaaaaaggttactaagtgatggacaacagcaccttacg 6360 
gaaagcctgagagaaaagtgctctagaataaaagagcttttgaagagatactcagagatg 6420 
gatgatcattatgagtgcttgaatagattgtctcttgacttggagaaggaaattgaattc 6480 
caaaaagagctttcaatgagagttaaagcaaacctctcacttccctatttacaaaccaaa 6540 
cacattgaaaaactttttactgcaaaccagagatgctccatggaattccacagaatcatg 6600 
aagaaactgaagtatgtgttaagctatgttacaaaaataaaagaagaacaacatgaatcc 6660 
atcaataaatttgaaatggattttattgatgaagtggaaaagcaaaaggaattgctaatt 6720 
aaaatacagcaccttcaacaagattgtgatgtaccatccagagaattaagggatctcaaa 6780 
ttgaaccagaatatggatctacatattgaggaaattctcaaagatttctcagaaagtgag 6840 
ttccctagcataaagactgaatttcaacaagtactaagtaataggaaagaaatgacacag 6900 
tttttggaagagtggttaaatactcgttttgatatagaaaagcttaaaaatggcatccag 6960 
aaagaaaatgataggatttgtcaagtgaataacttctttaataacagaataattgccata 7020 
atgaatgaatcaacagagtttgaggaaagaagtgctaccatatccaaagagtgggaacag 7080 
gacctgaaatcactgaaagagaaaaatgaaaaactatttaaaaactaccaaacattgaag 7140 
acttccttggcatctggtgcccaggttaatcctaccacacaagacaataagaatcctcat 7200 
gttacatcaagagctacacagttaaccacagagaaaattcgagagctggaaaattcactg 7260 
catgaagctaaagaaagtgctatgcataaggaaagcaagattataaagatgcagaaagaa 7320 
cttgaggtgactaatgacataatagcaaaacttcaagccaaagttcatgaatcaaataaa 7380 
tgccttgaaaaaacaaaagagacaattcaagtacttcaggacaaagttgctttaggagct 7440 
aagccatataaagaagaaattgaagatctcaaaatgaagcttgtgaaaatagacctagag 7500 
aaaatgaaaaatgccaaagaatttgaaaaggaaatcagtgctacaaaagccactgtagaa 7560 
tatcaaaaggaagttataaggctattgagagaaaatctcagaagaagtcaacaggcccaa 7620 
gatacctcagtgatatcagaacatactgatcctcagccttcaaataaacccttaacttgt 7680 
ggaggtggcagcggcattgtacaaaacacaaaagctcttattttgaaaagtgaacatata 7740 
aggctagaaaaagaaatttctaagttaaagcagcaaaatgaacagctaataaaacaaaag 7800 
aatgaattgttaagcaataatcagcatctttccaatgaggtcaaaacttggaaggaaaga 7860 
acccttaaaagagaggctcacaaacaagtaacttgtgagaattctccaaagtctcctaaa 7920 
gtgactggaacagcttctaaaaagaaacaaattacaccctctcaatgcaaggaacggaat 7980 
ttacaagatcctgtgccaaaggaatcaccaaaatcttgtttttttgatagccgatcaaag 8040 
tctttaccatcacctcatccagttcgctattttgataactcaagtttaggcctttgtcca 8100 
gaggtgcaaaatgcaggagcagagagtgtggattctcagccaggtccttggcacgcctcc 8160 
tcaggcaaggatgtgcctgagtgcaaaactcagtagactcctctttgtcacttctctgga 8220 
gatccagcattccttatttggaaatgactttgtttatgtgtctatccctggtaatgatgt 8280 
tgtagtgcagcttaatttcaattcagtctttactttgccactagagttgaaagataaggg 8340 
aacaggaaatgaatgcattgtggtaatttagaatggtgatagcaataccttcttcttgca 8400 
tatggtaatacttttaaaagttgaattgttttatttatttgtatattttgtaaagaataa 8460 
agttattgaaagaaatgtaaagttatctacatgacttagcatattccaaagcataataca 8520 
tacattaatataaaacatcattttattaacaaaattgtaaatgtttttaataccttacac 8580 
attcaataaatgtttagtagttctgaatcaccaaaaaaaaaaaaaaaaaa             8630 
 
 
<210> 970 
<211> 8613 
<212> DNA 
<213> Macaca mulatta 
  
<220>   
<223> cDNA sequence of rhesus KIF10 

<300>
<308> XM_001110512.1
<309> 2006-06-14
  
<400> 970 
taaatttaaaggcggggcggaccgtgcgccctgaagcgtcggccgcggagggtcctggcc 60 
attttcctgggacttgttcagcctaacacgatggcggaggaaggagctgtggccgtctgc 120 
gtgcgagtgcggccgctgaacagcagagaagaatcacttggagaaactgcccaagtttac 180 
tggaaaactgacaataatgccatttatcaagttgatggaagtaaatccttcaattttgat 240 
cgtgtctttcatggtaatgaaactaccaaaaatgtgtatgaagaaatagcagcaccaatc 300 
atcgattctgccatacaaggctacaatggtactatatttgcctatggacagaccgcttca 360 
ggaaaaacatataccatgatgggttcagaagatcatttgggagttacacccagggcaatt 420 
catgacattttccaaaaaattaagaagtttcctgatagggaatttctcttacgtgtatct 480 
tacatggaaatatacaatgaaaccattacagatttactctgtggcactcaaaaaatgaaa 540 
cctctaattattcgagaagatgtcaataggaatgtgtatgttgctgatctcacagaagaa 600 
gttgtatatacatcagaaatggctttgaagtggattacaaagggagaaaagaacaggcat 660 
tatggagaaacaaaaatgaatcaaagaagcagtcgttctcataccatctttaggatgatt 720 
ttggaaagtagagagaaaggtgaaccttctaattgtgaaggatctgttaaggtatcccat 780 
ttgaatttggttgatcttgcaggcagtgaaagagctgctcaaacaggagctgaaggtgtg 840 
cggctcaaggaaggctgtaatataaatcgaagcttatttattttgggacaagtgatcaag 900 
aaacttagtgatggacaggttggtggtttcataaattatcgagatagcaagttaacacga 960 
attctccagaattccttgggaggaaacgcaaagacacgtattatctgcacaattactcca 1020 
gtatcttttgatgaaacccttactactctccagtttgccagtactgctaaatatatgaag 1080 
aatactccttatgttaatgaggtatcaactgatgaagctctcctgaaaaggtatagaaaa 1140 
gaaataatggatcttaaaaaacaattagaggaggtttctttagagacgcgagctcaggca 1200 
atggaaaaagaccaattggcccaacttttggaagaaaaagatttgcttcagaaagtacag 1260 
aatgagaaaattgaaaacttaacacgaatgctggtgacctcttcttccctcacatcacaa 1320 
caggaattaaaggctaaaagaaaacgaagagttacttggtgtcttggcaaaattaacaaa 1380 
atgaagaactcaaactatgtagatcaatttaatatgccaacaaatataacaacaaaaacc 1440 
cacaagctgtctataaatgtattaggagaaattgatgaatctgtctgttcagagtctgat 1500 
gttttcagtaacactcttgatacattaaatgagatagaatggaatccagcaacaaagcta 1560 
ctaaatcaggagaatatagaaagtgagttgaactcacttcgtgctgactatgataatctg 1620 
gtattagactatgaacaactacgaacagaaaaagaagaaatggaattgaaattaaaagaa 1680 
aagaatgatttggatgaatttgaggctctagaaagaaaaactaaaaaagatcaagagatg 1740 
caactaattcatgaaatttcgaacttaaagaatttagttaagcatgcagaagtatataat 1800 
caagatcttgagaatgaactaagttcaaaagtagagctgcttagagaaaaggaagaccag 1860 
attaagaagctacaggaatacatcgactctcaaaagctagaaaatataaaaatggacttg 1920 
tcatactcattggaaagcattgaagaccaaaaacaaatgaaacagactctgtttgatgct 1980 
gaaactgtagcccttgatgccaagagagaatcagcctttcttagaagtgaaaatctggag 2040 
ctgaaggagaaaatgcaagaacttgcaagtacatacaagcaaatggaaaatgatattcag 2100 
ttgtatcaaagccaattggaggcaaaaaagaaaatgcaagttgatctggagaaagaatta 2160 
caatctgcttttaatgagataacaaaactcacctcccttatagatggcaaagttccaaaa 2220 
gatttgctctataatttggaattggaaggaaagattactgatcttcagaaagaactaaat 2280 
aaagaagttgaagaaaatgaagctttgcggaaagaagtcaatttgctttcagaattgaaa 2340 
tctttaccttctgaagtagaaagactgaggaaagagatacatgacaaatctgaagagctc 2400 
catataataacatcagaaaaacataaattattttctgaagtagttcataaggagagtaga 2460 
gttcaaggtttacttgaagaaattgggaaaacaaaagatgacctagcaactacccagtca 2520 
aattataaaagcactgatcaggaattccaaaatttcaaaagccttcatattgactttgag 2580 
caaaagtataagatggtccttgaggagaatgcgagaatgaatcaggaaatagttaatctc 2640 
tctaaagaagcacaaaaatttgattcaagtttggatgctttgaagaccgagctttcttac 2700 
aagacccaagaacttcagaagaaaacatgtgaggttcaagaaagactaaatgagatgaaa 2760 
gagctgaaggaacaattagaaaatagagattctacactgcaaactgtagaaagggagaaa 2820 
acactgattactgagaaactgcagcaaactttagaagaagtaaaaactttaactcaagaa 2880 
aaagatgacctaaaacaactccaaaagagcttgcaaattgagagggaccaactcaaaagt 2940 
gatattcacgatactgtaaacatgaacatagatactcaagaacaattacgaaatgctctt 3000 
gaatctttgaaacaacatcaagaaacaattaatacactaaaattgaaaatttctgaggaa 3060 
gtttccaggaatttgcatatggaggaaaatacaggagaaactaaagatgaatttcagcaa 3120 
aagatggttgacatagataaaaaacaggatttggaagctaaaaatacccaaacactaact 3180 
gcagatgttaaggatgatgagataatcgagcaacagaggaagatattttctttaatacag 3240 
gagaagaatgaactccaacaagtgttagagagtgttatagcagaaaaggaacaattgaag 3300 
actgacctaaaggaaaatattgaaatgaccattgaaaaccaggaagaattaagaattctt 3360 
ggagatgaacttaaaaagcagcaagagatagttgcacaagaaaagaaccataccataaag 3420 
aaagaagaagagctttctaggacctgtgacagactggcagaagttgaagaaaaactaaag 3480 
gaaaagagccagcaactccaagaaaaacagcaacaacttcttaatgtacaagaagagatg 3540 
agtgagatgcagaaaaagattaatgaaatggagaatttaaagaatgaattaaagaacaaa 3600 
gaattgacattggaacatagggaaacagagagacttgggttggctcagaaacttaatgaa 3660 
aattatgaggaaatgaaatctataaccaaagaaagaaaagttctaaaggaattacaggag 3720 
tcatttgaaacagagagagaccaacttagaggatatataagagaaattgaagctacaggc 3780 
ctacaaacaaaagaagaactaaaaattgctcacattcacctaaaagaacaccaagaaact 3840 
attgatgaactaagaagaagtgtatctgagaagacagctcaaataataaatattcaggac 3900 
ttagaaaaatcctataccaaattacaagaagagatcccagtgcttaatgaggaacgggag 3960 
ttacttcctaatgtgaaagaagtcagtgagactcaggaaacagtgaatgaactggagtta 4020 
ttaaaagaacagtccacaatcaaggactcaacaacactggcaagcatagaaatggaaagg 4080 
ctcaagttgaatgaaaaatttcaagaaagtcaggaagagataaaatctctaaccaaggaa 4140 
agagacaaccttaaaatgataaaagaagcccttgaagttaaacatgaccagctgaaagaa 4200 
cacattagagaaactttggctaaaatccaagagtctcaaagcaaacaagaacagtcctta 4260 
aatatgaaagaaaaagacaatgagactactaaaattctgagtgagatggagcaattcaaa 4320 
cccaaagattcagcactactaaggatagaaatagaaatgctcagattgtccaaaagactt 4380 
caagaaagtcatgatgaaatgaaatctgtagctaaggagaaagatgacctacagaggctg 4440 
caagaagttcttcagtctgaaagtgaccagctcaaagaaaatataaaagaaattgcagct 4500 
aaacacctggaaactgaagaggaacttaaagttgttcattgttgcctgaaagaacaaaag 4560 
gaaactattgatgagttaagagtgaatatttcagagaaggaaactgaaatatcaaccatt 4620 
caaaaagaattagaagcaatcaatgataagttacagaacaagatccaggagatttataag 4680 
aaagaggaacaacttaatataaaacgaattagtgagactcaggaaaaagtgaatgaactg 4740 
aaacaattcaaggaatatctcaaagccaaggattcaacactacaaagtatagaaagtaag 4800 
atgctcgagttgactagcagacttcaagaaagtcaagaagaaatacaaattatgattaag 4860 
gaaaaagaggaaatgaaaagagtacaggaggcccttcagatagagagagaccaactgcaa 4920 
gaaaacactaaagaaattatagctaaaatgcaagaatctcaagaaaaagaatatcagttt 4980 
cttaagatgacagctgtcaatgagactcaggaaaaaatgtgtgaaatagaacacttgaag 5040 
gagcaatttgagacccagaagttaaacctggaaaacacagaaacggagaatataaggttg 5100 
actcagatactacatgaaaaccttgaagaaatgagatctgtaacaaaagaaagagatgac 5160 
cttaggaatgtggaggagacgctcaaagtagagagagaccagctcaaggaaaaccttaga 5220 
gaaactataactagagacctagaaaaacaagaggagctaaaaattgttcacatgtatctg 5280 
aaggagcaccaagaaactattgatgaactcagagggattgtttcagagaaaacaaatgaa 5340 
atatcaaatatgcaaaaggacttagaaaactcaaatgctgcattaaaagcacaggatctg 5400 
aaaaaacaagaggaactaagaattgctcacatgcatctgaaagagcaccaggaaactatt 5460 
gacaaactcagaggaattgtttctgagaagacagataaaatatcaaatatgcaaaaagat 5520 
ttagaaaattcaaatgctaaattacaagaaaagattcaagaacttaaggcaaatgaacat 5580 
caactttttaagttaaaaaaagatgtcaatgagacacagaaaaaagtgtccgaaatggag 5640 
caactaaagaaacaaataaaagaccaaagcttaactctgagtaaaatagaaacagagaac 5700 
ttaaatttggctcagaaacttcatgaaaaccttgaagaaatgaaatctgtaatgaaagaa 5760 
agagataatctaagaagagtagaggaaacactcaaactggagagagaccaactcatggaa 5820 
agcctacaagaaaccaaagctagagatctggaaatacaacaggaactaaaaactgctcat 5880 
atgctatcaaaagaacacaaggaaactattgataagcttagagaaaaaattttagaaaag 5940 
acaactcaaatttcaaacattcaaaaggatttagataaatcaaaagatgaattacagaaa 6000 
aagatccaagaacttcagaaaaaagaacttcatctgcttagaatgaaagaagatgtcaat 6060 
atgagtcataaaaaaattaatgagatggaacagttgaagaagcaatttgaggcccaaaac 6120 
ttatctgtgcaaaatgtgagaatggataacttccagttgactaagaaacttcatgaaagc 6180 
cttgaagaaattagaattgtagctaaagaaagagatgagctaaggaggataaaagaatct 6240 
ctcaaaatggaaggggaccaattcgtagcaaccttaagggaaatgatagctagagaccaa 6300 
cagaaccaccaagtaaaacctgaaaagaggttactaagtgatggacaacagcaccttaca 6360 
gaaagcctgagagaaaagtgctctagaataaaagagcttttgaagagatactcagagatg 6420 
gatgatcattatgagtgcttgaatagattgtctcttgacttggagaaggaaattgaaatc 6480 
caaaaagagctttcaatgagagttaaagcaaacctctcacttccctatttacaaaccaaa 6540 
cacattgaaaaactttttactgcaaaccagagatgttccatggaattccacagaatcatg 6600 
aagaaacttaagtatgtgttaagctatgttagaaaaataaaagaagaacaacatgagtcc 6660 
atcaataaatttgaaatggattttattgatgaagtggaaaagcaaaaggaattgctaatt 6720 
aaaatacagcaccttcaacaagattgtgatgtaccatccagagaattaagggatctcaaa 6780 
ttgaaccagaatatggatctacatattgaggaaattctcaaagatttctcagaaagtgag 6840 
ttccctaccataaagactgaatttcagcaaatactaagtaataggaaagaaatgacacag 6900 
tttttggaagagtggttaaatactcgttttgatatagaaaagcttaaaaatggcatccag 6960 
aaagaaaatgataggatttgtcaaatgaataacttctttaataacagaataattgccata 7020 
atgaatgaatcaacagagtttgaggaaagaagtgctaccatatccaaagagtgggaacag 7080 
gacctgaaatcactgaaagagaaaaatgaaaaactatttaaaaactaccaaacattaaag 7140 
acctccttggcatctggtgcccaggttaatcctaccacacaagacaataagaatcctcat 7200 
gttacatcaagagctacacagttaaccacagagaaaattcgagaactggaaaattcacta 7260 
catgaagctaaagaaagtgctatgcataaggaaagcgagattataaagatgcagaaagaa 7320 
cttgaggtgactaatgacatgatagcaaaacttcaagccaaagttaatgaatcaaataaa 7380 
tgcctggaaacaacaaaagagacaattcaagtacttcaggacaaagttgctttaggagct 7440 
aagccgtataaagaagaaattgaagatctcaaaacgaagcttgtgaaaatagacctagag 7500 
aaaatgaaaaatgccaaagaatttgaaaaggaaatcagtgctacaaaagccactgtagaa 7560 
tatcaaaaggaagttatacggctattgagagaaaatctcagaagaagtcaacaggcccaa 7620 
gatacctcaatgatatcagaacatactgattctcagccttcaaataaacccttaacttgt 7680 
ggaggtggcagcggcattgtacaaaacacaaaagctcttattttgaaaagtgaacatata 7740 
aggctagaaaaggaaatttctaagttaaagcagcaaaatgaacagctaataaagcaaaag 7800 
aatgacttgttaagcaataatcagcatctttccaatgaggtcaaaacttggaaggaaaga 7860 
acacttaaaagagaggcttacaaacaagtaacttgtgagaattctccgaagtctcctaaa 7920 
gtgactggaacagcttctaaaaagaaacaaattacaccctctcaatgcaaggaacggaat 7980 
ttacatgatcctatgccaaaggaatcaccaaaatcttggttttttgatagccgatcaaag 8040 
tctttaccatcacctcatccagttcgctattttgataactcaaatttaggtctttgtcca 8100 
gaggtacaaaatgcaggagcagagagcgtggattctcagccaggtccttggcacgcctcc 8160 
tcaggaaaagatgtgcctgagtgcaaaactcagtagactcctcttcgtcacttctctgga 8220 
ggtccagcattccttgtttggaaatgactttgtttatgtgtctgtccctggtaatgatgt 8280 
cgtagtgcagcttaatttcaattcaggctttactttgccactagagttgaaatataaggg 8340 
aacaggaaatgaatgcattgtggtaatttagaatggtgatagcaataccttcttcttctt 8400 
gcatatggtaatacttttaaaagttgaattgttttatttatttgtatattttgtaaagaa 8460 
taaagttattgaaaggaatgtaaagttacctacatgacttagcatattccaaagcataac 8520 
acatacattaatataaaacattttattaacaaaattgtaaacatttttaataccttacac 8580 
attcaataaatgtttagtagttctgaatcacca                               8613 


<210> 971 
<211> 8618 
<212> DNA 
<213> Macaca fascicularis 
  
<220>   
<223> cDNA sequence of cynomolgous monkey KIF10 
  
<220>   
<221> modified_base 
<222> 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 1935, 2220, 2221, 2379, 2380, 2381, 2382, 2383, 2384, 2385, 2386, 2387, 2388, 2389, 2390, 2391, 2392, 2393, 2394, 2395, 2396, 2397, 2398, 2399, 2400, 2401, 2402, 2403, 2404, 2405, 2406, 2407, 2408, 2409, 2410, 2411, 2412, 2413, 2414, 2415, 2416, 2417, 2418, 2419, 2420, 2421, 2422, 2423, 2424, 2425, 2426, 2427, 2428, 2429, 2430, 2431, 2432, 3936, 3937, 3938, 3939, 3940, 3941, 3942, 3943, 3944, 3945, 3946, 3947, 3948, 3949, 3950, 3951, 3952, 3953, 3954, 3955, 3956, 3957, 3958, 3959, 3960, 3961, 3962, 3963, 3964, 3965, 3966, 3967, 3968, 3969, 3970, 3971, 3972, 3973, 3974, 3975, 3976, 3977, 3978, 3979, 3980, 3981, 3982, 3983, 3984, 3985, 3986, 3987, 3988, 3989, 3990, 3991, 3992, 3993, 3994, 3995, 3996, 3997, 3998, 3999, 4000, 4001, 4002, 4003, 4004, 4005, 4006, 4007, 4008, 4009, 4010, 4011, 4012, 4013, 4014, 4015, 4016, 4017, 4018, 4019, 4020, 4021, 4022, 4023, 4024, 4025, 4026, 4027, 4028, 4029, 4030, 4031, 4032, 4033, 4034, 4035, 4036, 4037, 4038, 4039, 4040, 4041, 4042, 4043, 4044, 4045, 4046, 4047, 4048, 4049, 4050, 4051, 4052, 4053, 4054, 4055, 4056, 4057, 4058, 4059, 4060, 4061, 4062, 4063, 4064, 4065, 4066, 4067, 4068, 4069, 4070, 4071, 4072, 4073, 4074, 4075, 4076, 4077, 4078, 4079, 4080, 4081, 4082, 4083, 4084, 4085, 4086, 4087, 4088, 4089, 4090, 4091, 4092, 4093, 4094, 4095, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4104, 4105, 4106, 4107, 4108, 4109, 4110, 4111, 4112, 4113, 4114, 4115, 4116, 4117, 4118, 4119, 4120, 4121, 4122, 4123, 4124, 4125, 4126, 4127, 4128, 4129, 4130, 4131, 4132, 4133, 4134, 4135, 4136, 4137, 4138, 4139, 4140, 4141, 4142, 4143, 4144, 4145, 4146, 4147, 4148, 4149, 4150, 4151, 4152, 4153, 4154, 4155, 4156, 4157, 4158, 4159, 4160, 4161, 4162, 4163, 4164, 4165, 4166, 4167, 4168, 4169, 4170, 4171, 4172, 4173, 4174, 4175, 4176, 4177, 4178, 4179, 4180, 4181, 4182, 4183, 4184, 4185, 4186, 4187, 4188, 4189, 4190, 4191, 4192, 4193, 4194, 4195, 4196, 4301, 4667, 4668, 4669, 4670, 4671, 4672, 4673, 4674, 4675, 4676, 4677, 4678, 4679, 4680, 4681, 4682, 4683, 4684, 4685, 4686, 4687, 4688, 4689, 4690, 4691, 4692, 4693, 4694, 4695, 4696, 4697, 4698, 4699, 4700, 4701, 4702, 4703, 4704, 4705, 4706, 4707, 4708, 4709, 4710, 4711, 4712, 4713, 4714, 4715, 4716, 4717, 4718, 4719, 4720, 4721, 4722, 4723, 4724, 4725, 4726, 4727, 4728, 4729, 4730, 4731, 4732, 4733, 4734, 4735, 4736, 4737, 4738, 4739, 4740, 4741, 4742, 4743, 4744, 4745, 4746, 4747, 4748, 4749, 4750, 4751, 4752, 4753, 4754, 4755, 4756, 4757, 4758, 4759, 4760, 4761, 4762, 4763, 4764, 4765, 4766, 4767, 4768, 4769, 4770, 4771, 4772, 4773, 4774, 4775, 4776, 4777, 4778, 4779, 4780, 4781, 4782, 4783, 4784, 4785, 4786, 4787, 4788, 4789, 4790, 4791, 4792, 4793, 4794, 4795, 4796, 4797, 4798, 4799, 4800, 4801, 4802, 4803, 4804, 4805, 4806, 4807, 4808, 4809, 4810, 4811, 4812, 4813, 4814, 4815, 4816, 4817, 4818, 4819, 4820, 4821, 4822, 4823, 4824, 4825, 4826, 4827, 4828, 4829, 4830, 4831, 4832, 4833, 4834, 4835, 4836, 6007, 6008, 6009, 6010, 6011, 6012, 6013, 6014, 6015, 6016, 6017, 6018, 6019, 6020, 6021, 6022, 6023, 6024, 6025, 6026, 6027, 6028, 6029, 6030, 6031, 6032, 6033, 6034, 6035, 6036, 6046, 6047, 6048, 6049, 6050, 6051, 6052, 6053, 6054, 6055, 6056, 6057, 6058, 6059, 6060, 6061, 6062, 6063, 6064, 6065, 6066, 6067, 6068, 6069, 6070, 6071, 6072, 6073, 6074, 6075, 6076, 6077, 6114, 6117, 6376, 6377, 6378, 6379, 6380, 6381, 6382, 6383, 6384, 6385, 6386, 6387, 6388, 6389, 6390, 6391, 6392, 6393, 6394, 6395, 6396, 6397, 6398, 6399, 7356, 7357, 7358, 7359, 7360, 7361, 7362, 7363, 7364, 7365, 7366, 7367, 7368, 7369, 7370, 7371, 7372, 7373, 7374, 7375, 7376, 7377, 7378, 7379, 7380, 7381, 7382, 7383, 7384, 7385, 7386, 7387, 7388, 7389, 7390, 7391, 7392, 7393, 7394, 7395, 7396, 7397, 7398, 7399, 7400, 7401, 7402, 7403, 7404, 7405, 7406, 7407, 7408, 7409, 7410, 7411, 7412, 7413, 7414, 7415, 7416, 7417, 7418, 7419, 7420, 7421, 7422, 7423, 7424, 7541, 7543, 7637, 7638, 7639, 7640, 7641, 7642, 7643, 7644, 7645, 7646, 7647, 7648, 7649, 7650, 7651, 7652, 7653, 7654, 7655, 7656, 7657, 7658, 7659, 7660, 7661, 7662, 7663, 7664, 7665, 7666, 7667, 7668, 7669, 7670, 7671, 7672, 7673, 7674, 7675, 7676, 7677, 7678, 7679, 7680, 8086, 8087, 8091, 8095, 8096, 8097, 8098, 8105, 8127, 8128, 8129, 8130, 8131, 8132, 8133, 8134, 8135, 8136, 8137, 8138, 8139, 8140, 8141, 8142, 8143, 8144, 8145, 8146, 8147, 8148, 8149, 8150, 8151, 8152, 8153, 8154, 8155, 8156, 8157, 8158, 8159, 8160, 8161, 8162, 8163, 8164, 8165, 8166, 8167, 8168, 8169, 8170, 8171, 8172, 8173, 8174, 8175, 8176, 8177, 8178, 8179, 8180, 8181, 8182, 8183, 8184, 8185, 8186, 8187, 8188, 8189, 8190, 8191, 8192, 8193, 8194, 8195, 8196, 8197, 8198, 8199, 8200, 8201, 8202, 8203, 8204, 8205, 8206, 8207, 8208, 8209, 8210, 8211, 8212, 8213, 8214, 8215, 8216, 8217, 8218, 8219, 8220, 8221, 8222, 8223, 8224, 8225, 8226, 8227, 8228, 8229, 8230, 8231, 8232, 8233, 8234, 8235, 8236, 8237, 8238, 8239, 8240, 8241, 8242, 8243, 8244, 8245, 8246, 8247, 8248, 8249, 8250, 8251, 8252, 8253, 8254, 8255, 8256, 8257, 8258, 8259, 8260, 8261, 8262, 8263, 8264, 8265, 8266, 8267, 8268, 8269, 8270, 8271, 8272, 8273, 8274, 8275, 8276, 8277, 8278, 8279, 8280, 8281, 8282, 8283, 8284, 8285, 8286, 8287, 8288 
<223> /mod_base = "unknown nucleotide" 
  
<400> 971 
taaatttaaaggcggggcggcccgtgcgccctgaagcgtcggccgcggagggtcctggcc 60 
attttcctgggacctgttcagcctaacacgatggcggaggaannnnnnnnnnnnnnnnnn 120 
nnnnnnnnnnnnnnnnnnnnnnnnagagaagaatcacttggagaaactgcccaagtttac 180 
tggaaaactgacaataatgccatttatcaagttgatggaagtaaatccttcaattttgat 240 
cgtgtctttcatggtaatgaaactaccaaaaatgtgtatgaagaaatagcagcaccaatc 300 
atcgattctgccatacaaggctacaatggtactatatttgcctatggacagaccgcttca 360 
ggaaaaacatataccatgatgggttcagaagatcatttgggagttacacccagggcaatt 420 
catgacattttccaaaaaattaagaagtttcctgatagggaatttctcttacgtgtatct 480 
tacatggaaatatacaatgaaaccattacagatttactctgtggcactcaaaaaatgaaa 540 
cctctaattattcgagaagatgtcaataggaatgtgtatgttgctgatctcacagaagaa 600 
gttgtatatacatcagaaatggctttgaagtggattacaaagggagaaaagaacaggcat 660 
tatggagaaacaaaaatgaatcaaagaagcagtcgttctcataccatctttaggatgatt 720 
ttggaaagtagagagaaaggtgaaccttctaattgtgaaggatctgttaaggtatcccat 780 
ttgaatttggttgatctagcaggcagtgaaagagctgctcaaacaggagctgaaggtgtg 840 
cggctcaaggaaggctgtaatataaatcgaagcttatttattttgggacaagtgatcaag 900 
aaacttagtgatggacaggttggtggtttcataaattatcgagatagcaagttaacacga 960 
attctccagaattccttgggaggaaacgcaaagacacgtattatctgcacaattactcca 1020 
gtatcttttgatgaaacccttactactctccagtttgccagtactgctaaatatatgaag 1080 
aatactccttatgttaatgaggtatcaactgatgaagctctcctgaaaaggtatagaaaa 1140 
gaaataatggatcttaaaaaacaattagaggaggtttctttagagacgcgagctcaggca 1200 
atggaaaaagaccaattggcccaacttttggaagaaaaagatttgcttcagaaagtacag 1260 
aatgagaaaattgaaaacttaacacgaatgctggtgacctcttcttccctcacatcacaa 1320 
caggaattaaaggctaaaagaaaacgaagagttacttggtgtcttggcaaaattaacaaa 1380 
atgaagaactcaaactatgtagatcaatttaatatgccaacaaatataacaacaaaaacc 1440 
cacaagctgtctataaatgtattaggagaaattgatgaatctgtctgttcagagtctgat 1500 
gttttcagtaacactcttgatacattaaatgagatagaatggaatccagcaacaaagcta 1560 
ctaaatcaggagaatatagaaagtgagttgaactcacttcgtgctgactatgataacctg 1620 
gtattagactatgaacaactacgaacagaaaaagaagaaatggaattgaaattaaaagaa 1680 
aagaatgatttggatgaatttgaggctctagaaagaaaaactaaaaaagatcaagagatg 1740 
caactaattcatgaaatttcgaacttaaagaatttagttaagcatgcagaagtatataat 1800 
caagatcttgagaatgaactaagttcaaaagtagagctgcttagagaaaaggaagaccag 1860 
attaagaagctacaggaatacatcgactctcaaaagctagaaaatataaaaatggacttg 1920 
tcatactcattgganagcattgaagaccaaaaacaaatgaaacagactctgtttgatgct 1980 
gaaactgtagcccttgatgccaagagagaatcagcctttcttagaagtgaaaatctggag 2040 
ctgaaggagaaaatgcaagaacttgcaagtacatacaagcaaatggaaaatgatattcag 2100 
ttatatcaaagccaattggaggcaaaaaagaaaatgcaagttgatctggagaaagaatta 2160 
caatctgcttttaatgagataacaaaactcacctcccttatatttaccaaaaactttctn 2220 
nagatttgctctataatttggaattggaaggaaagattactgatcttcagaaagaactaa 2280 
ataaagaagttgaagaaaatgaagctttgcggaaagaagtcaatttgctttcagaattga 2340 
aatctttaccttctgaagtagaaagactgaggaaagagnnnnnnnnnnnnnnnnnnnnnn 2400 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttttctgaagtagttcataaggagagta 2460 
gagttcaaggtttacttgaagaaattgggaaaacaaaagatgacctagcaactacccagt 2520 
caaattataaaagcactgatcaggaattccaaaatttcaaaagccttcatattgactttg 2580 
agcaaaagtataagatggtccttgaggagaatgcgagaatgaatcaggaaatagttaatc 2640 
tctctaaagaagcacaaaaatttgattcaagtttggatgctttgaagaccgagctttctt 2700 
acaagacccaagaacttcagaagaaaacatgtgaggttcaagaaagactaaatgagatgg 2760 
aagagctgaaggaacaattagaaaatagagattctacactgcaaactgtagaaagggaga 2820 
aaacactgattactgagaaactgcagcaaactttagaagaagtaaaaactttaactcaag 2880 
aaaaagatgacctaaaacaactccaaaagagcttgcaaattgagagggaccaactcaaaa 2940 
gtgatattcacgatactgtaaacatgaacatagatactcaagaacaattacgaaatgctc 3000 
ttgaatctttgaaacaacatcaagaaacaattaatacactaaaattgaaaatttctgagg 3060 
aagtttccaggaatttgcatatggaggaaaatacaggagaaactaaagatgaatttcagc 3120 
aaaagatggttgacatagataaaaaacaggatttggaagctaaaaatacccaaacactaa 3180 
ctgcagatgttaaggatgatgagataatcgagcaacagaggaagatattttctttaatac 3240 
aggagaagaatgaactccaacaagtgttagagagtgttatagcagaaaaggaacaattga 3300 
agactgacctaaaggaaaatattgaaatgaccattgaaaaccaggaagaattaagaattc 3360 
ttggagatgaacttaaaaagcagcaagagatagttgcacaagaaaagaaccataccataa 3420 
agaaagaagaagagctttctaggacctgtgacagactggcagaagttgaagaaaaactaa 3480 
aggaaaagagccagcaactccaagaaaaacagcaacaacttcttaatgtacaagaagaga 3540 
tgagtgagatgcagaaaaagattaatgaaatggagaatttaaagaatgaattaaagaaca 3600 
aagaattgacattggaacatagggaaacagagagacttgggttggctcagaaacttaatg 3660 
aaaattatgaggaaatgaaatctataaccaaagaaagaaaagttctaaaggaattacagg 3720 
agtcatttgaaacagagagagaccaacttagaggatatataagagaaattgaagctacag 3780 
gcctacaaacaaaagaagaactaaaaattgctcacattcacctaaaagaacaccaagaaa 3840 
ctattgatgaactaagaagaagtgtatctgagaagacagctcaaataataaatattcagg 3900 
acttagaaaaatcctataccaaattacaagaagagnnnnnnnnnnnnnnnnnnnnnnnnn 3960 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4020 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4080 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4140 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaag 4200 
aacacattagagaaactttggctaaaatccaagagtctcaaagcaaacaagaacagtcct 4260 
taaaatatgaaagaaaaagacaatgagactacaaaaattcntgagtgagatggagcaatt 4320 
caaacccaaagattcagcactactaaggatagaaatagaaatgctcagattgtccaaaag 4380 
acttcaagaaagtcatgatgaaatgaaatctgtagctaaggagaaagatgacctacagag 4440 
gctgcaagaagttcttcagtctgaaagtgaccagctcaaagaaaatataaaagaaattgc 4500 
agctaaacacctggaaactgaagaggaacttaaagttgttcattgttgcctgaaagaaca 4560 
aaaggaaactattgatgagttaagagtgaatatttcagagaaggaaactgaaatatcaac 4620 
cattcaaaaagaattagaagcaatcaatgataaattacagaacaagnnnnnnnnnnnnnn 4680 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4740 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 4800 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcaagaagaaatacaaattatgat 4860 
taaggaaaaagaggaaatgaaaagagtacaggaggcccttcagatagagagagaccaact 4920 
gcaagaaaacactaaagaaattatagctaaaatgcaagaatctcaagaaaaagaatatca 4980 
gtttcttaagatgacagctgtcaatgagactcaggaaaaaatgtgtgaaatagaacactt 5040 
gaaggagcaatttgagacccagaagttaaacctggaaaacacagaaacggagaatataag 5100 
gttgactcagatactacatgaaaaccttgaagaaatgagatctgtaacaaaagaaagaga 5160 
tgaccttaggaatgtggaggagacgctcaaagtagagagagaccagctcaaggaaaacct 5220 
tagagaaactataactagagacctagaaaaacaagaggagctaaaattgttcacatgtat 5280 
ctgaaggagcaccaagaaactattgatgaactcagagggattgtttcagagaaaacaaat 5340 
gaaatatcaaatatgcaaaaggacttagaaaactcaaatgctgccttaaaagcacaggat 5400 
ctgaaaaaacaagaggaactaagaattgctcacatgcatctgaaagagcaccaggaaact 5460 
attgacaaactcagaggaattgtttctgagaagacagataaaatatcaaatatgcaaaaa 5520 
gatttagaaaattcaaatgctaaattacaagaaaagattcaagaacttaaggcaaatgaa 5580 
catcaactttttaagttaaaaaaagatgtcaatgagacacagaaaaaaagtgtccgaaat 5640 
ggagcaactaaagaaacaactaaaagaccaaagcttaactctgagtaaaatagaaacaga 5700 
gaacttaaatttggctcagaaacttcatgaaaaccttgaagaaatgaaatctgtaatgaa 5760 
agaaagagataatctaagaagagtagaggaaacactcaaactggagagagaccaactcat 5820 
ggaaagcctacaagaaaccaaagctagagatctggaaatacaacaggaactaaaaactgc 5880 
tcatatgctatcaaaagaacacaaggaaactattgataagcttagagaaaaaattttaga 5940 
aaagacaactcaaatttcaaacattcaaaaggatttagataaatcaaaagatgaattaca 6000 
gaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnaactgcttannnnnnnnnnnnnnnn 6060 
nnnnnnnnnnnnnnnnaaaattaatgagatggaacagttgaagaagacaattngangccc 6120 
aaaacttatctgtgcaaaatgtgagaatggataacttccagttgactaagaaacttcatg 6180 
aaagccttgaagaaattagaattgtagctaaagaaagagatgagctaaggaggataaaag 6240 
aatctctcaaaatggaaagggaccaattcgtagcaaccttaagggaaatgatagctagag 6300 
accaacagaaccaccaagtaaatcctgaaaagaggttactaagtgatggacaacagcacc 6360 
ttacagaaagcctgnnnnnnnnnnnnnnnnnnnnnnnngagcttttgaagagatactcag 6420 
agatggatgatcattatgagtgcttgaatagattgtctcttgacttggagaaggaaattg 6480 
aaatccaaaaagagctttcaatgagagttaaagcaaacctctcacttccctatttacaaa 6540 
ccaaacacattgaaaaactttttactgcaaaccagagatgttccatggaattccacagaa 6600 
tcatgaagaaacttaagtatgtgttaagctatgttacaaaaataaaagaagaacaacatg 6660 
agtccatcaataaatttgaaatggattttaattgatgaagtggaaaagcaaaaggaattg 6720 
ctaattaaaatacagcaccttcaacaagattgtgatgtaccatccagagaattaagggat 6780 
ctcaaattgaaccagaatatggatctacatattgaggaaattctcaaagatttctcagaa 6840 
agtgagttccctaccataaagactgaatttcagcaaatactaagtaataggaaagaaatg 6900 
acacagtttttggaagagtggttaaatactcgttttgatatagaaaagcttaaaaatggc 6960 
atccagaaagaaaatgataggatttgtcaaatgaataacttctttaataacagaataatt 7020 
gccataatgaatgaatcaacagagtttgaggaaagaagtgctaccatatccaaagagtgg 7080 
gaacaggacctgaaatcactgaaagagaaaaatgaaaaactatttaaaaactaccaaaca 7140 
ttaaagacctccttggcatctggtgcccaggttaatcctaccacacaagacaataagaat 7200 
cctcatgttacatcaagagctacacagttaaccacagagaaaattcgagaactggaaaat 7260 
tcactacatgaagctaaagaaagtgctatgcataaggaaagcgagattataaagatgcag 7320 
aaagaacttgaggtgactaatgacatgatagcaannnnnnnnnnnnnnnnnnnnnnnnnn 7380 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggacaaagttgcttta 7440 
ggagctaagccgtataaagaagaaattgaagatctcaaaacgaagcttgtgaaaatagac 7500 
ctagagaaaatgaaaaatgccaaagaatttgaaaaggagntnactgctacaaaagccact 7560 
gtagaatatcaaaaggaagttatacggctattgagagaaaatctcagaagaagtcaacag 7620 
gcccaagatacctcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna 7680 
acttgtggaggtggcagcggcattgtacaaaacacaaaagctcttattttgaaaagtgaa 7740 
catataaggctagaaaaggaaatttctaagttaaagcagcaaaatgaacagctaataaag 7800 
caaaagaatgacttgttaagcaataatcagcatctttccaatgaggtcaaaacttggaag 7860 
gaaagaacacttaaaagagaggcttacaaacaagtaacttgtgagaattctccgaagtct 7920 
cctaaagtgactggaacagcttctaaaaagaaacaaattacaccctctcaatgcaaggaa 7980 
cggaatttacatgatcctacgccaaaggaatcaccaaaatcttggttttttgatagccga 8040 
tcaaagtctttaccatcacctcatccagttcgctattttgataanncatntttnnnnctt 8100 
tctncagaggtacaaaatgcaggagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 8160 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 8220 
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 8280 
nnnnnnngtagtgcagcttaatttcaattcaggctttactttgccactagagttgaaata 8340 
taagggaacaggaaatgaatgcattgtggtaatttagaatggtgatagcaataccttctt 8400 
cttcttgcatatggtaatacttttaaaagttgaattgttttatttatttgtatattttgt 8460 
aaagaataaagttattgaaaggaatgtaaagttacctacatgacttagcatattccaaag 8520 
cataacacatacattaatataaaacattttattaacaaaattgtaaacatttttaatacc 8580 
ttacacattcaataaatgtttagtagttctgaatcacc                          8618 
 
 
<210> 972 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: primer for psiCHECK insert 
  
<400> 972 
tgtccgcaac tacaacgcct  20 
 
 
<210> 973 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 973 
gaatttgcca tgggtggaat tttttctctt ggaaagaaag t 41 
 
 
<210> 974 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 974 
ggagggatct cgctcctgga tttttctctt ggaaagaaag t 41 
 
 
<210> 975 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 975 
ccccagcctt ctccatggtt ttttctcttg gaaagaaagt  40 
 
 
<210> 976 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 976 
gctcccccct gcaaatgagt ttttctcttg gaaagaaagt  40 
 
 
<210> 977 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 977 
agccttgacg gtgccatgtt tttaggcata ggacccgtgt ct 42 
 
 
<210> 978 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 978 
gatgacaagc ttcccgttct ctttttaggc ataggacccg tgtct 45 
 
 
<210> 979 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 979 
agatggtgat gggatttcca tttttttagg cataggaccc gtgtct 46 
 
 
<210> 980 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 980 
gcatcgcccc acttgatttt tttttaggca taggacccgt gtct 44 
 
 
<210> 981 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 981 
cacgacgtac tcagcgccat ttttaggcat aggacccgtg tct 43 
 
 
<210> 982 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 982 
ggcagagatg atgacccttt tgtttttagg cataggaccc gtgtct 46 
 
 
<210> 983 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human GAPDH 
  
<400> 983 
ggtgaagacg ccagtggact c 21 
 
 
<210> 984 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 984 
cgccccgcct ttaaattttt tttctcttgg aaagaaagt 39 
 
 
<210> 985 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 985 
gcacttcagg gctcacaggc tttttgaagt taccgtttt 39 
 
 
<210> 986 
<211> 33 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 986 
accctccgcg gccgtttttc tgagtcaaag cat 33 
 
 
<210> 987 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 987 
cccaggaaaa tggccaggtt tttctcttgg aaagaaagt 39 
 
 
<210> 988 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 988 
ccatcctatc aggctgaact ggttttttga agttaccgtt tt 42 
 
 
<210> 989 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 989 
ccacggctcc ttcctccgtt tttctgagtc aaagcat 37 
 
 
<210> 990 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 990 
cactcgcacg cagacggttt ttctcttgga aagaaagt 38 
 
 
<210> 991 
<211> 36 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 991 
ctgctgttca gcggccgttt ttgaagttac cgtttt 36 
 
 
<210> 992 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 992 
gcagtttctc caagtgattc ttcttttttc tgagtcaaag cat 43 
 
 
<210> 993 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 993 
ttgtcagttt tccagtaaac ttggtttttg aagttaccgt ttt 43 
 
 
<210> 994 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 994 
ttccatcaac ttgataaatg acattatttt tctgagtcaa agcat 45 
 
 
<210> 995 
<211> 25 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 995 
acacgatcaa aattgaagga tttac 25 
 
 
<210> 996 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 996 
ttttggtagt ttcattacca tgaaagtttt tctcttggaa agaaagt 47 
 
 
<210> 997 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 997 
ggtgctgcta tttcttcata cacatttttt ctcttggaaa gaaagt 46 
 
 
<210> 998 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 998 
cttgtatggc agaatcgatg atttttttga agttaccgtt tt 42 
 
 
<210> 999 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 999 
cataggcaaa tatagtacca ttgtagcttt ttctgagtca aagcat 46 
 
 
<210> 1000 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 1000 
tgtttttcct gaagcagtct gtctttttga agttaccgtt tt 42 
 
 
<210> 1001 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 1001 
gatcttctga acccatcatg gtatattttt ctgagtcaaa gcat 44 
 
 
<210> 1002 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence sequence: bDNA probes for human KIF10 
  
<400> 1002 
gccctgggta taactcccaa attttttctc ttggaaagaa agt 43 



1


