<110> F. Hoffmann-La Roche AG 
  
<120> COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF PTP1B GENES 
  
<130> XXX 
  
<160> 1101 



<210> 1 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 11, 12 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 1 
augcauguaa ggucuucuut t 21 
 
 
  
  
<210> 2 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 2 
aagaagaccu uacaugcaut t 21 
 
 
  
  
<210> 3 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 8, 9, 10, 11, 12, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 3 
aaacucgaga gaucuuacat t 21 
 
 
  
  
<210> 4 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 4 
uguaagaucu cucgaguuut t 21 
 
 
  
  
<210> 5 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 5 
ugauggagaa agguucguut t 21 
 
 
  
  
<210> 6 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 6 
aacgaaccuu ucuccaucat t 21 
 
 
  
  
<210> 7 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 11, 12, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 7 
ggagaaaggu ucguuaaaat t 21 
 
 
  
  
<210> 8 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 8 
uuuuaacgaa ccuuucucct t 21 
 
 
  
  
<210> 9 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 12, 13, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 9 
aaaugaggaa guuucggaut t 21 
 
 
  
  
<210> 10 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 10 
auccgaaacu uccucauuut t 21 
 
 
  
  
<210> 11 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 8, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 9, 12, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 11 
auaucaacgc uaguuugaut t 21 
 
 
  
  
<210> 12 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 12 
aucaaacuag cguugauaut t 21 
 
 
  
  
<210> 13 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 9, 10, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 13 
cacugaaguu agaagucggt t 21 
 
 
  
  
<210> 14 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 14 
ccgacuucua acuucagugt t 21 
 
 
  
  
<210> 15 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 11, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 15 
cccuucuucc guugauauct t 21 
 
 
  
  
<210> 16 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 16 
gauaucaacg gaagaagggt t 21 
 
 
  
  
<210> 17 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 9, 10, 11, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 12, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 17 
ucgucaugcu caacagagut t 21 
 
 
  
  
<210> 18 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 18 
acucuguuga gcaugacgat t 21 
 
 
  
  
<210> 19 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 19 
gauggagaaa gguucguuat t 21 
 
 
  
  
<210> 20 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 20 
uaacgaaccu uucuccauct t 21 
 
 
  
  
<210> 21 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 9, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 21 
gaucuuacau uuccacuaut t 21 
 
 
  
  
<210> 22 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 22 
auaguggaaa uguaagauct t 21 
 
 
  
  
<210> 23 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 10, 11, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 8, 9, 12, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 23 
ucccuuugac cauagucggt t 21 
 
 
  
  
<210> 24 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 24 
ccgacuaugg ucaaagggat t 21 
 
 
  
  
<210> 25 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 10, 11, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 9, 12, 13, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 25 
auagucggau uaaacuacat t 21 
 
 
  
  
<210> 26 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 8, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 26 
uguaguuuaa uccgacuaut t 21 
 
 
  
  
<210> 27 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 8, 9, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 10, 11, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 27 
cuaguucuca aucacugcut t 21 
 
 
  
  
<210> 28 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 28 
agcagugauu gagaacuagt t 21 
 
 
  
  
<210> 29 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 11, 12, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 9, 10, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 29 
cuagaucuag uucucaauct t 21 
 
 
  
  
<210> 30 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 30 
gauugagaac uagaucuagt t 21 
 
 
  
  
<210> 31 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 12, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 8, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 31 
gaaguuagaa gucgggucgt t 21 
 
 
  
  
<210> 32 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 32 
cgacccgacu ucuaacuuct t 21 
 
 
  
  
<210> 33 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 9, 10, 11, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 8, 12, 13 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 33 
cguacugguu uaaccuccut t 21 
 
 
  
  
<210> 34 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 34 
aggagguuaa accaguacgt t 21 
 
 
  
  
<210> 35 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 10, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 9, 11, 12, 13, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 35 
auuucaaaau ggacguacut t 21 
 
 
  
  
<210> 36 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 36 
aguacgucca uuuugaaaut t 21 
 
 
  
  
<210> 37 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 8, 10, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 9, 11, 12, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 37 
gaaugcaugu aaggucuuct t 21 
 
 
  
  
<210> 38 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 38 
gaagaccuua caugcauuct t 21 
 
 
  
  
<210> 39 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 8, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 9, 10, 11, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 39 
caugauguga gauuacuuut t 21 
 
 
  
  
<210> 40 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 11, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 40 
aaaguaaucu cacaucaugt t 21 
 
 
  
  
<210> 41 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 11, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 9, 10, 12, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 41 
gguacagaga cgucagucct t 21 
 
 
  
  
<210> 42 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 42 
ggacugacgu cucuguacct t 21 
 
 
  
  
<210> 43 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 11, 13, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 9, 10, 12, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 43 
uauuauacag ugcgacagct t 21 
 
 
  
  
<210> 44 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 44 
gcugucgcac uguauaauat t 21 
 
 
  
  
<210> 45 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 45 
auguuagaga gguagcgagt t 21 
 
 
  
  
<210> 46 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 46 
cucgcuaccu cucuaacaut t 21 
 
 
  
  
<210> 47 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 10, 11, 12, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 9, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 47 
ugcuauaugc cuuaagccat t 21 
 
 
  
  
<210> 48 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 48 
uggcuuaagg cauauagcat t 21 
 
 
  
  
<210> 49 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 8, 9, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 10, 11, 13, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 49 
ccuuaagcca auauuuacut t 21 
 
 
  
  
<210> 50 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 50 
aguaaauauu ggcuuaaggt t 21 
 
 
  
  
<210> 51 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 9, 10, 11, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 12, 13, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 51 
uuucaaaguc cgagagucat t 21 
 
 
  
  
<210> 52 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 52 
ugacucucgg acuuugaaat t 21 
 
 
  
  
<210> 53 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 11, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 53 
guuagagagg uagcgagcut t 21 
 
 
  
  
<210> 54 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 54 
agcucgcuac cucucuaact t 21 
 
 
  
  
<210> 55 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 9, 13, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 8, 10, 11, 12, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 55 
cacccaaacg aauccuggat t 21 
 
 
  
  
<210> 56 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 56 
uccaggauuc guuugggugt t 21 
 
 
  
  
<210> 57 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 13, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 57 
gacccuucuu ccguugauat t 21 
 
 
  
  
<210> 58 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 58 
uaucaacgga agaaggguct t 21 
 
 
  
  
<210> 59 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 10, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 9, 11, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 59 
guacagagac gucaguccct t 21 
 
 
  
  
<210> 60 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 60 
gggacugacg ucucuguact t 21 
 
 
  
  
<210> 61 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 7, 10, 11, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 8, 9, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 61 
acguacuggu uuaaccucct t 21 
 
 
  
  
<210> 62 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 62 
ggagguuaaa ccaguacgut t 21 
 
 
  
  
<210> 63 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 8, 12, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 63 
cccuguuauc ugcuagauct t 21 
 
 
  
  
<210> 64 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 64 
gaucuagcag auaacagggt t 21 
 
 
  
  
<210> 65 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 9, 10, 11, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 65 
cucagacauu ccaaggguat t 21 
 
 
  
  
<210> 66 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 66 
uacccuugga augucugagt t 21 
 
 
  
  
<210> 67 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 10, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 11, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 67 
ccggacggac guugguucut t 21 
 
 
  
  
<210> 68 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 68 
agaaccaacg uccguccggt t 21 
 
 
  
  
<210> 69 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 9, 10, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 8, 11, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 69 
ugcgacagcu agaauuggat t 21 
 
 
  
  
<210> 70 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 70 
uccaauucua gcugucgcat t 21 
 
 
  
  
<210> 71 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 8, 10, 11, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 9, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 71 
acguggguau uuaauaagat t 21 
 
 
  
  
<210> 72 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 9, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 72 
ucuuauuaaa uacccacgut t 21 
 
 
  
  
<210> 73 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 10, 11, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 8, 9, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 73 
ugaccauagu cggauuaaat t 21 
 
 
  
  
<210> 74 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 74 
uuuaauccga cuauggucat t 21 
 
 
  
  
<210> 75 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 9, 10, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 8, 11, 12, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 75 
uaucaacgcu aguuugauat t 21 
 
 
  
  
<210> 76 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 76 
uaucaaacua gcguugauat t 21 
 
 
  
  
<210> 77 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 11, 12, 13, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 7, 8, 9, 10, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 77 
cuuuucaaag uccgagagut t 21 
 
 
  
  
<210> 78 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 78 
acucucggac uuugaaaagt t 21 
 
 
  
  
<210> 79 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 9, 11, 13, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 10, 12, 14, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 79 
cacuauacca cauggccugt t 21 
 
 
  
  
<210> 80 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 80 
caggccaugu gguauagugt t 21 
 
 
  
  
<210> 81 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 8, 10, 11, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 9, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 81 
accugaucau uacauggcut t 21 
 
 
  
  
<210> 82 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 8, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 82 
agccauguaa ugaucaggut t 21 
 
 
  
  
<210> 83 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 8, 9, 10, 11, 12, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 83 
cagugacuuc ccauguagat t 21 
 
 
  
  
<210> 84 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 84 
ucuacauggg aagucacugt t 21 
 
 
  
  
<210> 85 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 12, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 85 
gagauuacuu ugucccgcut t 21 
 
 
  
  
<210> 86 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 86 
agcgggacaa aguaaucuct t 21 
 
 
  
  
<210> 87 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 11, 12, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 10, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 87 
ucaacgcuag uuugauaaat t 21 
 
 
  
  
<210> 88 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 88 
uuuaucaaac uagcguugat t 21 
 
 
  
  
<210> 89 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 10, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 9, 11, 12, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 89 
cauauuauac agugcgacat t 21 
 
 
  
  
<210> 90 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 90 
ugucgcacug uauaauaugt t 21 
 
 
  
  
<210> 91 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 91 
uauguuagag agguagcgat t 21 
 
 
  
  
<210> 92 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 92 
ucgcuaccuc ucuaacauat t 21 
 
 
  
  
<210> 93 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 9, 11, 12, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 8, 10, 13, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 93 
ccauagugca cuagcauuut t 21 
 
 
  
  
<210> 94 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 94 
aaaugcuagu gcacuauggt t 21 
 
 
  
  
<210> 95 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 95 
uugccuuucu cgugguagat t 21 
 
 
  
  
<210> 96 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 96 
ucuaccacga gaaaggcaat t 21 
 
 
  
  
<210> 97 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 12, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 9, 10, 11, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 97 
uaugccuuaa gccaauauut t 21 
 
 
  
  
<210> 98 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 11, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 98 
aauauuggcu uaaggcauat t 21 
 
 
  
  
<210> 99 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 8, 12, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 9, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 99 
ccauagucgg auuaaacuat t 21 
 
 
  
  
<210> 100 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 100 
uaguuuaauc cgacuauggt t 21 
 
 
  
  
<210> 101 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 12, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 101 
acccuucuuc cguugauaut t 21 
 
 
  
  
<210> 102 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 102 
auaucaacgg aagaagggut t 21 
 
 
  
  
<210> 103 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 103 
auagguacag agacgucagt t 21 
 
 
  
  
<210> 104 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 104 
cugacgucuc uguaccuaut t 21 
 
 
  
  
<210> 105 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 12, 13, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 8, 9, 10, 11, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 105 
ucuuuucaaa guccgagagt t 21 
 
 
  
  
<210> 106 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 106 
cucucggacu uugaaaagat t 21 
 
 
  
  
<210> 107 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 8, 10, 12, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 9, 11, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 107 
uccauagugc acuagcauut t 21 
 
 
  
  
<210> 108 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 108 
aaugcuagug cacuauggat t 21 
 
 
  
  
<210> 109 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 9, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 109 
ugauauugug gguaacgugt t 21 
 
 
  
  
<210> 110 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 10, 12, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 110 
cacguuaccc acaauaucat t 21 
 
 
  
  
<210> 111 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 11, 13, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 8, 9, 10, 12, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 111 
uuuaccagga uauccgacat t 21 
 
 
  
  
<210> 112 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 112 
ugucggauau ccugguaaat t 21 
 
 
  
  
<210> 113 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 10, 11, 12, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 9, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 113 
uuuucaaagu ccgagaguct t 21 
 
 
  
  
<210> 114 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 114 
gacucucgga cuuugaaaat t 21 
 
 
  
  
<210> 115 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 8, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 9, 10, 11, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 115 
cugaaguuag aagucgggut t 21 
 
 
  
  
<210> 116 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 116 
acccgacuuc uaacuucagt t 21 
 
 
  
  
<210> 117 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 9, 10, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 11, 12, 13, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 117 
uuugaguacc aaauccacat t 21 
 
 
  
  
<210> 118 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 118 
uguggauuug guacucaaat t 21 
 
 
  
  
<210> 119 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 8, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 119 
aaggguaugg gaagccauat t 21 
 
 
  
  
<210> 120 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 11, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 120 
uauggcuucc cauacccuut t 21 
 
 
  
  
<210> 121 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 8, 10, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 9, 11, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 121 
uaacacaugc ggucacuuut t 21 
 
 
  
  
<210> 122 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 122 
aaagugaccg cauguguuat t 21 
 
 
  
  
<210> 123 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 8, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 9, 10, 11, 12, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 123 
auggccaugg aauaaaccat t 21 
 
 
  
  
<210> 124 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 124 
ugguuuauuc cauggccaut t 21 
 
 
  
  
<210> 125 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 13, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 8, 11, 12, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 125 
uucuuccguu gauaucaagt t 21 
 
 
  
  
<210> 126 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 126 
cuugauauca acggaagaat t 21 
 
 
  
  
<210> 127 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 8, 10, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 9, 11, 12, 13, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 127 
gugauauugu ggguaacgut t 21 
 
 
  
  
<210> 128 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 11, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 128 
acguuaccca caauaucact t 21 
 
 
  
  
<210> 129 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 9, 10, 11, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 129 
uacucaucag gucauuauut t 21 
 
 
  
  
<210> 130 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 130 
aauaaugacc ugaugaguat t 21 
 
 
  
  
<210> 131 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 7, 10, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 8, 9, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 131 
uguggguaac gugagaagat t 21 
 
 
  
  
<210> 132 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 132 
ucuucucacg uuacccacat t 21 
 
 
  
  
<210> 133 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 8, 9, 10, 11, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 133 
aacucgagag aucuuacaut t 21 
 
 
  
  
<210> 134 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 134 
auguaagauc ucucgaguut t 21 
 
 
  
  
<210> 135 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 8, 9, 10, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 7, 11, 12, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 135 
ugcaugaccu gaucauuact t 21 
 
 
  
  
<210> 136 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 9, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 136 
guaaugauca ggucaugcat t 21 
 
 
  
  
<210> 137 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8, 9, 10, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 11, 12, 13, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 137 
guaguaguuu ggguguguat t 21 
 
 
  
  
<210> 138 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 9, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 7, 8, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 138 
uacacaccca aacuacuact t 21 
 
 
  
  
<210> 139 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 8, 9, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 139 
cugguuuaac cuccuaucct t 21 
 
 
  
  
<210> 140 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 140 
ggauaggagg uuaaaccagt t 21 
 
 
  
  
<210> 141 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 9, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 8, 10, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 141 
auugugggua acgugagaat t 21 
 
 
  
  
<210> 142 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 142 
uucucacguu acccacaaut t 21 
 
 
  
  
<210> 143 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 10, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 143 
uuagagaggu agcgagcugt t 21 
 
 
  
  
<210> 144 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 9, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 144 
cagcucgcua ccucucuaat t 21 
 
 
  
  
<210> 145 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 9, 11, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 10, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 145 
agugauauug uggguaacgt t 21 
 
 
  
  
<210> 146 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 8, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 146 
cguuacccac aauaucacut t 21 
 
 
  
  
<210> 147 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 13, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 9, 10, 11, 12, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 147 
uucuuuucaa aguccgagat t 21 
 
 
  
  
<210> 148 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 148 
ucucggacuu ugaaaagaat t 21 
 
 
  
  
<210> 149 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 12, 13, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 149 
auggagaaag guucguuaat t 21 
 
 
  
  
<210> 150 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 150 
uuaacgaacc uuucuccaut t 21 
 
 
  
  
<210> 151 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 9, 10, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 151 
acucgagaga ucuuacauut t 21 
 
 
  
  
<210> 152 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 152 
aauguaagau cucucgagut t 21 
 
 
  
  
<210> 153 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 8, 9, 10, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 11, 12, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 153 
ugcuagaucu aguucucaat t 21 
 
 
  
  
<210> 154 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 154 
uugagaacua gaucuagcat t 21 
 
 
  
  
<210> 155 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 8, 10, 12, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 9, 11, 13, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 155 
ccuaacacau gcggucacut t 21 
 
 
  
  
<210> 156 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 156 
agugaccgca uguguuaggt t 21 
 
 
  
  
<210> 157 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 8, 9, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 10, 11, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 157 
ggacguacug guuuaaccut t 21 
 
 
  
  
<210> 158 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 158 
agguuaaacc aguacgucct t 21 
 
 
  
  
<210> 159 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 11, 12, 13, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 159 
uuuacucauc aggucauuat t 21 
 
 
  
  
<210> 160 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 160 
uaaugaccug augaguaaat t 21 
 
 
  
  
<210> 161 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 10, 15, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 161 
gauuacuuug ucccgcuuat t 21 
 
 
  
  
<210> 162 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 162 
uaagcgggac aaaguaauct t 21 
 
 
  
  
<210> 163 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 9, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 10, 11, 12, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 163 
uuagaagucg ggucgugggt t 21 
 
 
  
  
<210> 164 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 164 
cccacgaccc gacuucuaat t 21 
 
 
  
  
<210> 165 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 9, 11, 13, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 8, 10, 12, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 165 
cuagcaggca ugccgcggut t 21 
 
 
  
  
<210> 166 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 166 
accgcggcau gccugcuagt t 21 
 
 
  
  
<210> 167 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 8, 12, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 9, 10, 11, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 167 
gauauugugg guaacgugat t 21 
 
 
  
  
<210> 168 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 11, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 10, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 168 
ucacguuacc cacaauauct t 21 
 
 
  
  
<210> 169 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 9, 11, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 10, 12, 13, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 169 
ucauauuaua cagugcgact t 21 
 
 
  
  
<210> 170 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 170 
gucgcacugu auaauaugat t 21 
 
 
  
  
<210> 171 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 10, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 171 
gccuuucucg ugguagaagt t 21 
 
 
  
  
<210> 172 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 172 
cuucuaccac gagaaaggct t 21 
 
 
  
  
<210> 173 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 9, 11, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 7, 8, 10, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 173 
uugccuaaca caugcgguct t 21 
 
 
  
  
<210> 174 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 174 
gaccgcaugu guuaggcaat t 21 
 
 
  
  
<210> 175 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 10, 11, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 9, 12, 13, 14, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 175 
ucgaaggugc caaauucaut t 21 
 
 
  
  
<210> 176 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 176 
augaauuugg caccuucgat t 21 
 
 
  
  
<210> 177 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 11, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 9, 10, 12, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 177 
auauaaugaa cacgugggut t 21 
 
 
  
  
<210> 178 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 12, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 178 
acccacgugu ucauuauaut t 21 
 
 
  
  
<210> 179 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 8, 9, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 7, 10, 11, 12, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 179 
accauagucg gauuaaacut t 21 
 
 
  
  
<210> 180 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 180 
aguuuaaucc gacuauggut t 21 
 
 
  
  
<210> 181 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 10, 11, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 9, 12, 14, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 181 
uaugggaagc cauauucact t 21 
 
 
  
  
<210> 182 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 182 
gugaauaugg cuucccauat t 21 
 
 
  
  
<210> 183 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 9, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 183 
cacauuuugc cuuucucgut t 21 
 
 
  
  
<210> 184 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 184 
acgagaaagg caaaaugugt t 21 
 
 
  
  
<210> 185 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 9, 10, 11, 12, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 13, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 185 
gaucuaguuc ucaaucacut t 21 
 
 
  
  
<210> 186 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 186 
agugauugag aacuagauct t 21 
 
 
  
  
<210> 187 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 9, 10, 12, 13, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 8, 11, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 187 
ugaccugauc auuacauggt t 21 
 
 
  
  
<210> 188 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 188 
ccauguaaug aucaggucat t 21 
 
 
  
  
<210> 189 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 9, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 8, 10, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 189 
cauauucaca ccucacgcut t 21 
 
 
  
  
<210> 190 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 190 
agcgugaggu gugaauaugt t 21 
 
 
  
  
<210> 191 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 8, 10, 11, 12, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 9, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 191 
gugagauuac uuugucccgt t 21 
 
 
  
  
<210> 192 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 192 
cgggacaaag uaaucucact t 21 
 
 
  
  
<210> 193 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 9, 13, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 8, 10, 11, 12, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 193 
cagaucgaca aguccgggat t 21 
 
 
  
  
<210> 194 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 194 
ucccggacuu gucgaucugt t 21 
 
 
  
  
<210> 195 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 8, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 195 
ugguuuaacc uccuauccut t 21 
 
 
  
  
<210> 196 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 196 
aggauaggag guuaaaccat t 21 
 
 
  
  
<210> 197 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 9, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 197 
aagcuuccua agaacaaaat t 21 
 
 
  
  
<210> 198 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 198 
uuuuguucuu aggaagcuut t 21 
 
 
  
  
<210> 199 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 11, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 7, 8, 9, 10, 12, 13, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 199 
cauuucaaaa uggacguact t 21 
 
 
  
  
<210> 200 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 200 
guacguccau uuugaaaugt t 21 
 
 
  
  
<210> 201 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 9, 10, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 8, 11, 12, 13, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 201 
ccuccacauu aaguggcuut t 21 
 
 
  
  
<210> 202 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 202 
aagccacuua auguggaggt t 21 
 
 
  
  
<210> 203 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 10, 13, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 9, 11, 12, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 203 
acagugcgac agcuagaaut t 21 
 
 
  
  
<210> 204 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 204 
auucuagcug ucgcacugut t 21 
 
 
  
  
<210> 205 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 10, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 205 
ugugagauua cuuuguccct t 21 
 
 
  
  
<210> 206 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 206 
gggacaaagu aaucucacat t 21 
 
 
  
  
<210> 207 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 7, 8, 10, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 9, 11, 12, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 207 
cuuugaccau agucggauut t 21 
 
 
  
  
<210> 208 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 208 
aauccgacua uggucaaagt t 21 
 
 
  
  
<210> 209 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 11, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 10, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 209 
aucugcuaga ucuaguucut t 21 
 
 
  
  
<210> 210 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 12, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 210 
agaacuagau cuagcagaut t 21 
 
 
  
  
<210> 211 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 9, 10, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 11, 12, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 211 
gacggacguu gguucugcat t 21 
 
 
  
  
<210> 212 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 212 
ugcagaacca acguccguct t 21 
 
 
  
  
<210> 213 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 13, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 9, 10, 11, 12, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 213 
gguucguuaa aaugcgcact t 21 
 
 
  
  
<210> 214 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 214 
gugcgcauuu uaacgaacct t 21 
 
 
  
  
<210> 215 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 9, 11, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 10, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 215 
cugcuauaug ccuuaagcct t 21 
 
 
  
  
<210> 216 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 216 
ggcuuaaggc auauagcagt t 21 
 
 
  
  
<210> 217 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 9, 13, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 10, 11, 12, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 217 
uuucaaaaug gacguacugt t 21 
 
 
  
  
<210> 218 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 218 
caguacgucc auuuugaaat t 21 
 
 
  
  
<210> 219 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 8, 9, 10, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 11, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 219 
uauaugccuu aagccaauat t 21 
 
 
  
  
<210> 220 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 9, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 220 
uauuggcuua aggcauauat t 21 
 
 
  
  
<210> 221 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 9, 10, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 8, 11, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 221 
gaccauaguc ggauuaaact t 21 
 
 
  
  
<210> 222 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 222 
guuuaauccg acuaugguct t 21 
 
 
  
  
<210> 223 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 8, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 9, 10, 11, 12, 13, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 223 
uacaacccaa gaaacucgat t 21 
 
 
  
  
<210> 224 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 224 
ucgaguuucu uggguuguat t 21 
 
 
  
  
<210> 225 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 7, 9, 11, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 8, 10, 12, 13, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 225 
cuaacacaug cggucacuut t 21 
 
 
  
  
<210> 226 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 226 
aagugaccgc auguguuagt t 21 
 
 
  
  
<210> 227 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 8, 9, 10, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 11, 12, 13, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 227 
ccggccaccc aaacgaauct t 21 
 
 
  
  
<210> 228 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 228 
gauucguuug gguggccggt t 21 
 
 
  
  
<210> 229 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 9, 10, 11, 12, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 8, 13, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 229 
gcgagcugcu cugcuauaut t 21 
 
 
  
  
<210> 230 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 230 
auauagcaga gcagcucgct t 21 
 
 
  
  
<210> 231 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 9, 14, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 231 
auuacuuugu cccgcuuaut t 21 
 
 
  
  
<210> 232 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 232 
auaagcggga caaaguaaut t 21 
 
 
  
  
<210> 233 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 10, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 9, 11, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 233 
ccauauucac accucacgct t 21 
 
 
  
  
<210> 234 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 234 
gcgugaggug ugaauauggt t 21 
 
 
  
  
<210> 235 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 10, 13, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 235 
acucaucagg ucauuauuut t 21 
 
 
  
  
<210> 236 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 236 
aaauaaugac cugaugagut t 21 
 
 
  
  
<210> 237 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 8, 9, 11, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 10, 12, 13 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 237 
auggugcuca cgacucuuct t 21 
 
 
  
  
<210> 238 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 238 
gaagagucgu gagcaccaut t 21 
 
 
  
  
<210> 239 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 8, 11, 12, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 239 
ucugcuuacu aaugugccct t 21 
 
 
  
  
<210> 240 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 10, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 240 
gggcacauua guaagcagat t 21 
 
 
  
  
<210> 241 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 11, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 241 
agauuacuuu gucccgcuut t 21 
 
 
  
  
<210> 242 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 242 
aagcgggaca aaguaaucut t 21 
 
 
  
  
<210> 243 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 10, 11, 12, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 8, 9, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 243 
aucgacaagu ccgggagcut t 21 
 
 
  
  
<210> 244 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 244 
agcucccgga cuugucgaut t 21 
 
 
  
  
<210> 245 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 11, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 245 
gcaacucucc acuccauaut t 21 
 
 
  
  
<210> 246 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 246 
auauggagug gagaguugct t 21 
 
 
  
  
<210> 247 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 9, 10, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 8, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 247 
ucgagagauc uuacauuuct t 21 
 
 
  
  
<210> 248 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 248 
gaaauguaag aucucucgat t 21 
 
 
  
  
<210> 249 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 9, 13, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 8, 10, 11, 12, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 249 
ccgacuagca ggcaugccgt t 21 
 
 
  
  
<210> 250 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 250 
cggcaugccu gcuagucggt t 21 
 
 
  
  
<210> 251 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 8, 13, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 251 
ugagauuacu uugucccgct t 21 
 
 
  
  
<210> 252 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 252 
gcgggacaaa guaaucucat t 21 
 
 
  
  
<210> 253 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 7, 8, 12, 13, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 9, 10, 11, 14, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 253 
gucggauuaa acuacaucat t 21 
 
 
  
  
<210> 254 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 254 
ugauguaguu uaauccgact t 21 
 
 
  
  
<210> 255 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 9, 11, 13, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 10, 12, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 255 
gccuaacaca ugcggucact t 21 
 
 
  
  
<210> 256 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 256 
gugaccgcau guguuaggct t 21 
 
 
  
  
<210> 257 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 10, 11, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 9, 12, 13, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 257 
auuuacucau caggucauut t 21 
 
 
  
  
<210> 258 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 258 
aaugaccuga ugaguaaaut t 21 
 
 
  
  
<210> 259 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 9, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 10, 11, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 259 
agagguagcg agcugcucut t 21 
 
 
  
  
<210> 260 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 260 
agagcagcuc gcuaccucut t 21 
 
 
  
  
<210> 261 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 9, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 261 
gguaguacug ggaauggaat t 21 
 
 
  
  
<210> 262 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 10, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 262 
uuccauuccc aguacuacct t 21 
 
 
  
  
<210> 263 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 12, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 263 
auucacaccu cacgcucugt t 21 
 
 
  
  
<210> 264 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 264 
cagagcguga ggugugaaut t 21 
 
 
  
  
<210> 265 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 9, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 8, 10, 11, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 265 
aacacaugcg gucacuuuut t 21 
 
 
  
  
<210> 266 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 266 
aaaagugacc gcauguguut t 21 
 
 
  
  
<210> 267 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 8, 12, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 9, 10, 11, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 267 
gcugcgucag accaguacut t 21 
 
 
  
  
<210> 268 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 268 
aguacugguc ugacgcagct t 21 
 
 
  
  
<210> 269 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 10, 11, 13, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 8, 9, 12, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 269 
auccuggagc cacacaaugt t 21 
 
 
  
  
<210> 270 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 270 
cauugugugg cuccaggaut t 21 
 
 
  
  
<210> 271 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 9, 10, 12, 13, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 11, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 271 
cucccgagcu acucucuugt t 21 
 
 
  
  
<210> 272 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 272 
caagagagua gcucgggagt t 21 
 
 
  
  
<210> 273 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 8, 9, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 10, 11, 12, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 273 
uuaggugcca ggcuguaagt t 21 
 
 
  
  
<210> 274 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 274 
cuuacagccu ggcaccuaat t 21 
 
 
  
  
<210> 275 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 8, 11, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 9, 10, 12, 13 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 275 
gccuggguga cgguccuuut t 21 
 
 
  
  
<210> 276 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 276 
aaaggaccgu cacccaggct t 21 
 
 
  
  
<210> 277 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 10, 11, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 8, 9, 12, 13, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 277 
aguuagaagu cgggucgugt t 21 
 
 
  
  
<210> 278 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 278 
cacgacccga cuucuaacut t 21 
 
 
  
  
<210> 279 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 279 
gaaagacccu ucuuccguut t 21 
 
 
  
  
<210> 280 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 280 
aacggaagaa gggucuuuct t 21 
 
 
  
  
<210> 281 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 8, 11, 12, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 7, 9, 10, 13, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 281 
acacaugcgg ucacuuuugt t 21 
 
 
  
  
<210> 282 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 282 
caaaagugac cgcaugugut t 21 
 
 
  
  
<210> 283 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 12, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 10, 11, 13, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 283 
uucaaaaugg acguacuggt t 21 
 
 
  
  
<210> 284 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 284 
ccaguacguc cauuuugaat t 21 
 
 
  
  
<210> 285 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 8, 9, 11, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 10, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 285 
ccuuugacca uagucggaut t 21 
 
 
  
  
<210> 286 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 286 
auccgacuau ggucaaaggt t 21 
 
 
  
  
<210> 287 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 8, 9, 10, 11, 12, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 13, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 287 
ggaguucuuc ccaaaucact t 21 
 
 
  
  
<210> 288 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 288 
gugauuuggg aagaacucct t 21 
 
 
  
  
<210> 289 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 12, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 10, 11, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 289 
auuuaccagg auauccgact t 21 
 
 
  
  
<210> 290 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 290 
gucggauauc cugguaaaut t 21 
 
 
  
  
<210> 291 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 6, 7, 13, 14, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 8, 9, 10, 11, 12, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 291 
ugaaguuaga agucggguct t 21 
 
 
  
  
<210> 292 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 292 
gacccgacuu cuaacuucat t 21 
 
 
  
  
<210> 293 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 10, 11, 13, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 9, 12, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 293 
uccacuauac cacauggcct t 21 
 
 
  
  
<210> 294 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 11, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 294 
ggccaugugg uauaguggat t 21 
 
 
  
  
<210> 295 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 295 
gugauggaga aagguucgut t 21 
 
 
  
  
<210> 296 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 296 
acgaaccuuu cuccaucact t 21 
 
 
  
  
<210> 297 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 9, 13, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 10, 11, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 297 
gugaggugug gauaaggcut t 21 
 
 
  
  
<210> 298 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 298 
agccuuaucc acaccucact t 21 
 
 
  
  
<210> 299 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 8, 9, 11, 13, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 299 
gucagccuug caucaagggt t 21 
 
 
  
  
<210> 300 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 300 
cccuugaugc aaggcugact t 21 
 
 
  
  
<210> 301 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 8, 9, 10, 11, 12, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 301 
gugacggucc uuuaggcagt t 21 
 
 
  
  
<210> 302 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 302 
cugccuaaag gaccgucact t 21 
 
 
  
  
<210> 303 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 10, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 9, 11, 12, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 303 
uauaccacau ggccugacut t 21 
 
 
  
  
<210> 304 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 9, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 304 
agucaggcca ugugguauat t 21 
 
 
  
  
<210> 305 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 9, 10, 11, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 13, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 305 
uauucacacc ucacgcucut t 21 
 
 
  
  
<210> 306 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 306 
agagcgugag gugugaauat t 21 
 
 
  
  
<210> 307 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 9, 10, 11, 12, 13, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 307 
ggugacgguc cuuuaggcat t 21 
 
 
  
  
<210> 308 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 308 
ugccuaaagg accgucacct t 21 
 
 
  
  
<210> 309 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 8, 9, 10, 11, 13, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 12, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 309 
augucagccu ugcaucaagt t 21 
 
 
  
  
<210> 310 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 310 
cuugaugcaa ggcugacaut t 21 
 
 
  
  
<210> 311 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 9, 11, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 10, 12, 13, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 311 
gcuaagagcg cgacgcggct t 21 
 
 
  
  
<210> 312 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 312 
gccgcgucgc gcucuuagct t 21 
 
 
  
  
<210> 313 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 9, 11, 12, 14, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 5, 8, 10, 13, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 313 
uuccacuaua ccacauggct t 21 
 
 
  
  
<210> 314 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 10, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 314 
gccauguggu auaguggaat t 21 
 
 
  
  
<210> 315 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 9, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 8, 10, 11, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 315 
auauuauaca gugcgacagt t 21 
 
 
  
  
<210> 316 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 316 
cugucgcacu guauaauaut t 21 
 
 
  
  
<210> 317 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 8, 9, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 7, 10, 11, 12, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 317 
agucggauua aacuacauct t 21 
 
 
  
  
<210> 318 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 318 
gauguaguuu aauccgacut t 21 
 
 
  
  
<210> 319 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 8, 10, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 319 
agaucuuaca uuuccacuat t 21 
 
 
  
  
<210> 320 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 320 
uaguggaaau guaagaucut t 21 
 
 
  
  
<210> 321 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 9, 10, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 11, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 321 
gauggugcuc acgacucuut t 21 
 
 
  
  
<210> 322 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 322 
aagagucgug agcaccauct t 21 
 
 
  
  
<210> 323 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 9, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 10, 11, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 323 
ccuuuaggca gccugccgct t 21 
 
 
  
  
<210> 324 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 324 
gcggcaggcu gccuaaaggt t 21 
 
 
  
  
<210> 325 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 9, 11, 12, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 10, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 325 
gaccuccaca uuaaguggct t 21 
 
 
  
  
<210> 326 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 326 
gccacuuaau guggagguct t 21 
 
 
  
  
<210> 327 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 327 
uuauucuccu cccuguuaut t 21 
 
 
  
  
<210> 328 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 328 
auaacaggga ggagaauaat t 21 
 
 
  
  
<210> 329 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 8, 11, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 9, 10, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 329 
gacguacugg uuuaaccuct t 21 
 
 
  
  
<210> 330 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 330 
gagguuaaac caguacguct t 21 
 
 
  
  
<210> 331 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8, 9, 10, 11, 12, 13, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 331 
gaaggagcuu ucccacgagt t 21 
 
 
  
  
<210> 332 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 332 
cucgugggaa agcuccuuct t 21 
 
 
  
  
<210> 333 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 9, 11, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 10, 12, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 333 
gaaaaccuua caacccaagt t 21 
 
 
  
  
<210> 334 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 334 
cuuggguugu aagguuuuct t 21 
 
 
  
  
<210> 335 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 7, 8, 9, 13, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 10, 11, 12, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 335 
uaaauccuca gguaguacut t 21 
 
 
  
  
<210> 336 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 336 
aguacuaccu gaggauuuat t 21 
 
 
  
  
<210> 337 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 13, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 337 
ggaucagccu ccgccauuct t 21 
 
 
  
  
<210> 338 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 338 
gaauggcgga ggcugaucct t 21 
 
 
  
  
<210> 339 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 9, 10, 12, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 11, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 339 
gguucaccuu gccgagagat t 21 
 
 
  
  
<210> 340 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 340 
ucucucggca aggugaacct t 21 
 
 
  
  
<210> 341 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 7, 9, 10, 11, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 8, 12, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 341 
ugauggugcu cacgacucut t 21 
 
 
  
  
<210> 342 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 12, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 342 
agagucguga gcaccaucat t 21 
 
 
  
  
<210> 343 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 9, 11, 12, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 10, 13, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 343 
uacauuucca cuauaccact t 21 
 
 
  
  
<210> 344 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 344 
gugguauagu ggaaauguat t 21 
 
 
  
  
<210> 345 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 8, 9, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 10, 11, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 345 
uacugguuua accuccuaut t 21 
 
 
  
  
<210> 346 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 10, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 346 
auaggagguu aaaccaguat t 21 
 
 
  
  
<210> 347 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 10, 14, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 8, 9, 11, 12, 13, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 347 
gcagaucgac aaguccgggt t 21 
 
 
  
  
<210> 348 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 348 
cccggacuug ucgaucugct t 21 
 
 
  
  
<210> 349 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 8, 10, 11, 13, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 9, 12, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 349 
gcaggcaugc cgcgguaggt t 21 
 
 
  
  
<210> 350 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 350 
ccuaccgcgg caugccugct t 21 
 
 
  
  
<210> 351 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 6, 7, 9, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 8, 10, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 351 
gcaugccgcg guagguaagt t 21 
 
 
  
  
<210> 352 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 352 
cuuaccuacc gcggcaugct t 21 
 
 
  
  
<210> 353 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 8, 11, 12, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 9, 10, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 353 
uugaccauag ucggauuaat t 21 
 
 
  
  
<210> 354 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 11, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 354 
uuaauccgac uauggucaat t 21 
 
 
  
  
<210> 355 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 9, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 8, 10, 11, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 355 
auaccacaug gccugacuut t 21 
 
 
  
  
<210> 356 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 356 
aagucaggcc augugguaut t 21 
 
 
  
  
<210> 357 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 7, 9, 12, 13, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 8, 10, 11, 14, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 357 
uuugaccaua gucggauuat t 21 
 
 
  
  
<210> 358 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 10, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 358 
uaauccgacu auggucaaat t 21 
 
 
  
  
<210> 359 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 359 
aaagacccuu cuuccguugt t 21 
 
 
  
  
<210> 360 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 360 
caacggaaga agggucuuut t 21 
 
 
  
  
<210> 361 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 7, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 8, 9, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 361 
aguucucaau cacugcucct t 21 
 
 
  
  
<210> 362 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 362 
ggagcaguga uugagaacut t 21 
 
 
  
  
<210> 363 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 11, 12, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 9, 10, 13, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 363 
ucggauuaaa cuacaucaat t 21 
 
 
  
  
<210> 364 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 364 
uugauguagu uuaauccgat t 21 
 
 
  
  
<210> 365 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 9, 11, 12, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 8, 10, 13, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 365 
uacagagacg ucagucccut t 21 
 
 
  
  
<210> 366 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 366 
agggacugac gucucuguat t 21 
 
 
  
  
<210> 367 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 8, 11, 12, 13, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 9, 10, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 367 
cgcgacgcgg ccuagagcgt t 21 
 
 
  
  
<210> 368 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 368 
cgcucuaggc cgcgucgcgt t 21 
 
 
  
  
<210> 369 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 9, 10, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 8, 11, 12, 13, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 369 
aagguucguu aaaaugcgct t 21 
 
 
  
  
<210> 370 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 370 
gcgcauuuua acgaaccuut t 21 
 
 
  
  
<210> 371 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 7, 8, 9, 10, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 11, 12, 13, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 371 
acgguccuuu aggcagccut t 21 
 
 
  
  
<210> 372 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 372 
aggcugccua aaggaccgut t 21 
 
 
  
  
<210> 373 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 8, 12, 13, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 9, 10, 11, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 373 
uaggugccag gcuguaagct t 21 
 
 
  
  
<210> 374 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 374 
gcuuacagcc uggcaccuat t 21 
 
 
  
  
<210> 375 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 10, 12, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 8, 9, 11, 13, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 375 
auuauacagu gcgacagcut t 21 
 
 
  
  
<210> 376 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 9, 14, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 376 
agcugucgca cuguauaaut t 21 
 
 
  
  
<210> 377 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 8, 9, 10, 11, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 12, 13, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 377 
aucuaguucu caaucacugt t 21 
 
 
  
  
<210> 378 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 378 
cagugauuga gaacuagaut t 21 
 
 
  
  
<210> 379 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 9, 10, 12, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 11, 13, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 379 
cuuaaaugcc gcacccuact t 21 
 
 
  
  
<210> 380 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 12, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 380 
guagggugcg gcauuuaagt t 21 
 
 
  
  
<210> 381 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 9, 14, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 10, 11, 12, 13, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 381 
agguucguua aaaugcgcat t 21 
 
 
  
  
<210> 382 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 382 
ugcgcauuuu aacgaaccut t 21 
 
 
  
  
<210> 383 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 6, 8, 11, 12, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 7, 9, 10, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 383 
caacacauag ccugacccut t 21 
 
 
  
  
<210> 384 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 384 
agggucaggc uauguguugt t 21 
 
 
  
  
<210> 385 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 10, 11, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 12, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 385 
ggcagccugc cgccgucuct t 21 
 
 
  
  
<210> 386 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 386 
gagacggcgg caggcugcct t 21 
 
 
  
  
<210> 387 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 8, 9, 10, 11, 12, 13, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 387 
gaaacucgag agaucuuact t 21 
 
 
  
  
<210> 388 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 388 
guaagaucuc ucgaguuuct t 21 
 
 
  
  
<210> 389 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 7, 8, 9, 10, 11, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 12, 13, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 389 
cuguagcucc cgagcuacut t 21 
 
 
  
  
<210> 390 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 390 
aguagcucgg gagcuacagt t 21 
 
 
  
  
<210> 391 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 9, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 391 
caugccgcgg uagguaaggt t 21 
 
 
  
  
<210> 392 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 8, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 392 
ccuuaccuac cgcggcaugt t 21 
 
 
  
  
<210> 393 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 9, 11, 12, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 10, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 393 
gggcccuuug ccuaacacat t 21 
 
 
  
  
<210> 394 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 394 
uguguuaggc aaagggccct t 21 
 
 
  
  
<210> 395 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 11, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 395 
uucacaccuc acgcucuggt t 21 
 
 
  
  
<210> 396 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 396 
ccagagcgug aggugugaat t 21 
 
 
  
  
<210> 397 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 8, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 9, 10, 11, 14 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 397 
uagcucccga gcuacucuct t 21 
 
 
  
  
<210> 398 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 398 
gagaguagcu cgggagcuat t 21 
 
 
  
  
<210> 399 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 7, 10, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 8, 9, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 399 
augccgcggu agguaagggt t 21 
 
 
  
  
<210> 400 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 400 
cccuuaccua ccgcggcaut t 21 
 
 
  
  
<210> 401 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 6, 7, 11, 12, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 8, 9, 10, 13, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 401 
cauagucgga uuaaacuact t 21 
 
 
  
  
<210> 402 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 402 
guaguuuaau ccgacuaugt t 21 
 
 
  
  
<210> 403 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 9, 13, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 8, 10, 11, 12, 14, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 403 
ugccgcggua gguaagggct t 21 
 
 
  
  
<210> 404 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 404 
gcccuuaccu accgcggcat t 21 
 
 
  
  
<210> 405 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 10, 11, 12, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 8, 9, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 405 
gcgacgcggc cuagagcggt t 21 
 
 
  
  
<210> 406 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 406 
ccgcucuagg ccgcgucgct t 21 
 
 
  
  
<210> 407 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 6, 7, 9, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 8, 10, 11 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 407 
ggugcucacg acucuuccut t 21 
 
 
  
  
<210> 408 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 408 
aggaagaguc gugagcacct t 21 
 
 
  
  
<210> 409 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 10, 12, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 8, 9, 11, 13, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 409 
acuagcaggc augccgcggt t 21 
 
 
  
  
<210> 410 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 410 
ccgcggcaug ccugcuagut t 21 
 
 
  
  
<210> 411 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 8, 10, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 9, 11, 12, 13, 14, 15, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 411 
aaauagguac agagacguct t 21 
 
 
  
  
<210> 412 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 11, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 412 
gacgucucug uaccuauuut t 21 
 
 
  
  
<210> 413 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 8, 9, 10, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 11, 12, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 413 
gaaacagccu gggugacggt t 21 
 
 
  
  
<210> 414 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 414 
ccgucaccca ggcuguuuct t 21 
 
 
  
  
<210> 415 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 7, 9, 11, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 8, 10, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 415 
agcaggcaug ccgcgguagt t 21 
 
 
  
  
<210> 416 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 10 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 416 
cuaccgcggc augccugcut t 21 
 
 
  
  
<210> 417 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 9, 10, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 8, 11, 12, 13, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 417 
gccauuuacc aggauaucct t 21 
 
 
  
  
<210> 418 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 418 
ggauauccug guaaauggct t 21 
 
 
  
  
<210> 419 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 7, 9, 12, 13, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 8, 10, 11, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 419 
gcgcgacgcg gccuagagct t 21 
 
 
  
  
<210> 420 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 420 
gcucuaggcc gcgucgcgct t 21 
 
 
  
  
<210> 421 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 8, 10, 12, 14, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 9, 11, 13, 15, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 421 
ugccuaacac augcggucat t 21 
 
 
  
  
<210> 422 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 422 
ugaccgcaug uguuaggcat t 21 
 
 
  
  
<210> 423 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 8, 9, 13, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 10, 11, 12, 14, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 423 
cggccaccca aacgaaucct t 21 
 
 
  
  
<210> 424 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 424 
ggauucguuu ggguggccgt t 21 
 
 
  
  
<210> 425 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7, 8, 11, 12, 13, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 9, 10, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 425 
gagacgucag ucccuuugat t 21 
 
 
  
  
<210> 426 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 426 
ucaaagggac ugacgucuct t 21 
 
 
  
  
<210> 427 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 7, 8, 10, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 9, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 427 
ggcaugccgc gguagguaat t 21 
 
 
  
  
<210> 428 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 428 
uuaccuaccg cggcaugcct t 21 
 
 
  
  
<210> 429 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 5, 8, 10, 13, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 6, 7, 9, 11, 12, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 429 
agcgcgacgc ggccuagagt t 21 
 
 
  
  
<210> 430 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 430 
cucuaggccg cgucgcgcut t 21 
 
 
  
  
<210> 431 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 8, 9, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 10, 11, 12, 13, 14, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 431 
agacauucca aggguauggt t 21 
 
 
  
  
<210> 432 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 432 
ccauacccuu ggaaugucut t 21 
 
 
  
  
<210> 433 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 7, 9, 10, 12, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 8, 11, 13, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 433 
ccacuauacc acauggccut t 21 
 
 
  
  
<210> 434 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 434 
aggccaugug guauaguggt t 21 
 
 
  
  
<210> 435 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 9, 10, 12, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 11, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 435 
ccgccggacc gcguagagat t 21 
 
 
  
  
<210> 436 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 436 
ucucuacgcg guccggcggt t 21 
 
 
  
  
<210> 437 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 13, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 437 
uuugccuuuc ucgugguagt t 21 
 
 
  
  
<210> 438 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 438 
cuaccacgag aaaggcaaat t 21 
 
 
  
  
<210> 439 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 7, 8, 9, 10, 11, 15, 16, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 12, 13, 14, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 439 
gaguucuucc caaaucacct t 21 
 
 
  
  
<210> 440 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 440 
ggugauuugg gaagaacuct t 21 
 
 
  
  
<210> 441 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 10, 11, 13, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 12, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 441 
agugacuucc cauguagagt t 21 
 
 
  
  
<210> 442 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 442 
cucuacaugg gaagucacut t 21 
 
 
  
  
<210> 443 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 5, 6, 7, 11, 15, 16, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 8, 9, 10, 12, 13, 14, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 443 
gccacccaaa cgaauccugt t 21 
 
 
  
  
<210> 444 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 444 
caggauucgu uuggguggct t 21 
 
 
  
  
<210> 445 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 9, 10, 11, 14, 15, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 8, 12, 13, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 445 
agcccacgcc cgacuagcat t 21 
 
 
  
  
<210> 446 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 446 
ugcuagucgg gcgugggcut t 21 
 
 
  
  
<210> 447 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 7, 9, 10, 12, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 8, 11, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 447 
caggcaugcc gcgguaggut t 21 
 
 
  
  
<210> 448 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 12 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 448 
accuaccgcg gcaugccugt t 21 
 
 
  
  
<210> 449 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 6, 7, 8, 12, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 9, 10, 11, 13, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 449 
ggccacccaa acgaauccut t 21 
 
 
  
  
<210> 450 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 450 
aggauucguu uggguggcct t 21 
 
 
  
  
<210> 451 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 10, 11, 12, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 9, 13, 14, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 451 
gagcccacgc ccgacuagct t 21 
 
 
  
  
<210> 452 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 452 
gcuagucggg cgugggcuct t 21 
 
 
  
  
<210> 453 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 9, 10, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 11, 12, 13, 14, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 453 
aacaaaaacc gaaauaggut t 21 
 
 
  
  
<210> 454 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 454 
accuauuucg guuuuuguut t 21 
 
 
  
  
<210> 455 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 8, 12, 14, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 7, 9, 10, 11, 13, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 455 
cgacuagcag gcaugccgct t 21 
 
 
  
  
<210> 456 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 456 
gcggcaugcc ugcuagucgt t 21 
 
 
  
  
<210> 457 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 11, 12, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 457 
uagguaaggg ccgccggact t 21 
 
 
  
  
<210> 458 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 458 
guccggcggc ccuuaccuat t 21 
 
 
  
  
<210> 459 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 8, 9, 10, 12, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 11, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 459 
cgcagagccc acgcccgact t 21 
 
 
  
  
<210> 460 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 460 
gucgggcgug ggcucugcgt t 21 
 
 
  
  
<210> 461 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 8, 9, 11, 12, 16, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 10, 13, 14, 15, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 461 
guaagggccg ccggaccgct t 21 
 
 
  
  
<210> 462 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 462 
gcgguccggc ggcccuuact t 21 
 
 
  
  
<210> 463 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 9, 11, 12, 13, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 8, 10, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 463 
agagcccacg cccgacuagt t 21 
 
 
  
  
<210> 464 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 464 
cuagucgggc gugggcucut t 21 
 
 
  
  
<210> 465 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 6, 8, 11, 12, 13, 14, 15, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 7, 9, 10, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 465 
guggcuacgg uccucacggt t 21 
 
 
  
  
<210> 466 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 466 
ccgugaggac cguagccact t 21 
 
 
  
  
<210> 467 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 6, 7, 8, 9, 10, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 11, 12, 13, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 467 
auaaauccuc agguaguact t 21 
 
 
  
  
<210> 468 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 5, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 468 
guacuaccug aggauuuaut t 21 
 
 
  
  
<210> 469 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 8, 9, 11, 14, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 10, 12, 13, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 469 
aggcaugccg cgguagguat t 21 
 
 
  
  
<210> 470 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 470 
uaccuaccgc ggcaugccut t 21 
 
 
  
  
<210> 471 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 11, 13, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 8, 9, 10, 12, 14, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 471 
gacuagcagg caugccgcgt t 21 
 
 
  
  
<210> 472 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 472 
cgcggcaugc cugcuaguct t 21 
 
 
  
  
<210> 473 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 11, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 12, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 473 
gaaauaggua cagagacgut t 21 
 
 
  
  
<210> 474 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 10, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 474 
acgucucugu accuauuuct t 21 
 

  
<210> 475 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 9, 10, 11, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 12, 13, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 475 
agucuaaucu cagggccuut t 21 
 
 
  
  
<210> 476 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 476 
aaggcccuga gauuagacut t 21 
 
 
  
  
<210> 477 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 8, 9, 11, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 10, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 477 
cuuuugacca cagucggaut t 21 
 
 
  
  
<210> 478 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 478 
auccgacugu ggucaaaagt t 21 
 
 
  
  
<210> 479 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 10, 11, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 8, 9, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 479 
ugaccacagu cggauuaaat t 21 
 
 
  
  
<210> 480 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 480 
uuuaauccga cuguggucat t 21 
 
 
  
  
<210> 481 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 7, 10, 11, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 6, 8, 9, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 481 
ugaccacagu cggauuaaat t 21 
 
 
  
  
<210> 482 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 482 
uuuaauccga cuguggucat t 21 
 
 
  
  
<210> 483 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 10, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 8, 9, 11, 12, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 483 
caucaugggc gacucgucat t 21 
 
 
  
  
<210> 484 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 484 
ugacgagucg cccaugaugt t 21 
 
 
  
  
<210> 485 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 9, 10, 11, 16, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 12, 13, 14, 15 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 485 
agucuaaucu cagggccuut t 21 
 
 
  
  
<210> 486 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 486 
aaggcccuga gauuagacut t 21 
 
 
  
  
<210> 487 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 8, 12, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 9, 10, 11, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 487 
accggaacag guaccgagat t 21 
 
 
  
  
<210> 488 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 488 
ucucgguacc uguuccggut t 21 
 
 
  
  
<210> 489 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 6, 10, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 5, 7, 8, 9, 11, 12, 16, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 489 
caucaugggc gacucgucat t 21 
 
 
  
  
<210> 490 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 490 
ugacgagucg cccaugaugt t 21 
 
 
  
  
<210> 491 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7, 9, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 10, 11, 12, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 491 
gagaugcgca gguuccgcat t 21 
 
 
  
  
<210> 492 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 492 
ugcggaaccu gcgcaucuct t 21 
 
 
  
  
<210> 493 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 8, 9, 11, 12, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 10, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 493 
gaaaggcucg uuaaaaugut t 21 
 
 
  
  
<210> 494 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 494 
acauuuuaac gagccuuuct t 21 
 
 
  
  
<210> 495 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 8, 12, 14, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 4, 5, 6, 7, 9, 10, 11, 13, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 495 
accggaacag guaccgagat t 21 
 
 
  
  
<210> 496 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 496 
ucucgguacc uguuccggut t 21 
 
 
  
  
<210> 497 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 10, 12, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 11, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 497 
ucguuaaaau gugcccagut t 21 
 
 
  
  
<210> 498 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 498 
acugggcaca uuuuaacgat t 21 
 
 
  
  
<210> 499 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 11, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 8, 9, 10, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 499 
aaucucaggg ccuuaaccut t 21 
 
 
  
  
<210> 500 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 500 
agguuaaggc ccugagauut t 21 
 
 
  
  
<210> 501 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 9, 10, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 8, 11, 12, 13, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 501 
aaggcucguu aaaaugugct t 21 
 
 
  
  
<210> 502 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 502 
gcacauuuua acgagccuut t 21 
 
 
  
  
<210> 503 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 10, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 9, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 503 
ggccuagcgc ggcggacggt t 21 
 
 
  
  
<210> 504 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 504 
ccguccgccg cgcuaggcct t 21 
 
 
  
  
<210> 505 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 11, 13, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 8, 9, 10, 12, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 505 
ccggaacagg uaccgagaut t 21 
 
 
  
  
<210> 506 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 506 
aucucgguac cuguuccggt t 21 
 
 
  
  
<210> 507 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 11, 13, 14, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 8, 9, 10, 12, 15, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 507 
ccggaacagg uaccgagaut t 21 
 
 
  
  
<210> 508 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 508 
aucucgguac cuguuccggt t 21 
 
 
  
  
<210> 509 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 8, 9, 11, 14, 15, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 6, 7, 10, 12, 13, 16, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 509 
cuuuugacca cagucggaut t 21 
 
 
  
  
<210> 510 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 510 
auccgacugu ggucaaaagt t 21 
 
 
  
  
<210> 511 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 10, 12, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 11, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 511 
ugggcgacuc gucagugcat t 21 
 
 
  
  
<210> 512 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 512 
ugcacugacg agucgcccat t 21 
 
 
  
  
<210> 513 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 6, 11, 12, 13, 14, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 7, 8, 9, 10, 15, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 513 
aaucucaggg ccuuaaccut t 21 
 
 
  
  
<210> 514 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 514 
agguuaaggc ccugagauut t 21 
 
 
  
  
<210> 515 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 10, 12, 13, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 11, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 515 
ugggcgacuc gucagugcat t 21 
 
 
  
  
<210> 516 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 516 
ugcacugacg agucgcccat t 21 
 
 
  
  
<210> 517 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 8, 11, 12, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 9, 10, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 517 
uugaccacag ucggauuaat t 21 
 
 
  
  
<210> 518 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 518 
uuaauccgac uguggucaat t 21 
 
 
  
  
<210> 519 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 5, 6, 8, 11, 12, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 7, 9, 10, 13, 14, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 519 
uugaccacag ucggauuaat t 21 
 
 
  
  
<210> 520 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 520 
uuaauccgac uguggucaat t 21 
 
 
  
  
<210> 521 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 9, 10, 11, 12, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 521 
ggcucguuaa aaugugccct t 21 
 
 
  
  
<210> 522 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 522 
gggcacauuu uaacgagcct t 21 
 
 
  
  
<210> 523 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 11, 13, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 8, 9, 10, 12, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 523 
cucguuaaaa ugugcccagt t 21 
 
 
  
  
<210> 524 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 8, 13 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 524 
cugggcacau uuuaacgagt t 21 
 
 
  
  
<210> 525 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 9, 10, 12, 13, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 11, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 525 
cugggcggcu auuuaccagt t 21 
 
 
  
  
<210> 526 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 526 
cugguaaaua gccgcccagt t 21 
 
 
  
  
<210> 527 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 7, 9, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 8, 10, 11, 12, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 527 
gagaugcgca gguuccgcat t 21 
 
 
  
  
<210> 528 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 528 
ugcggaaccu gcgcaucuct t 21 
 
 
  
  
<210> 529 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 13, 15, 17, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 9, 10, 11, 12, 14, 16 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 529 
ggcucguuaa aaugugccct t 21 
 
 
  
  
<210> 530 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 11 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 530 
gggcacauuu uaacgagcct t 21 
 
 
  
  
<210> 531 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 6, 7, 9, 10, 15, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 8, 11, 12, 13, 14, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 531 
aaggcucguu aaaaugugct t 21 
 
 
  
  
<210> 532 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 4, 9 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 532 
gcacauuuua acgagccuut t 21 
 
 
  
  
<210> 533 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 11, 12, 13, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 10, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 533 
ugggcggcua uuuaccaggt t 21 
 
 
  
  
<210> 534 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 534 
ccugguaaau agccgcccat t 21 
 
 
  
  
<210> 535 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 9, 12, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 10, 11, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 535 
gccuagcgcg gcggacggct t 21 
 
 
  
  
<210> 536 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 536 
gccguccgcc gcgcuaggct t 21 
 
 
  
  
<210> 537 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 9, 11, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 10, 12, 13, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 537 
aaguucauca ugggcgacut t 21 
 
 
  
  
<210> 538 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 538 
agucgcccau gaugaacuut t 21 
 
 
  
  
<210> 539 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 11, 13, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 7, 8, 9, 10, 12, 14, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 539 
cucguuaaaa ugugcccagt t 21 
 
 
  
  
<210> 540 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 540 
cugggcacau uuuaacgagt t 21 
 
 
  
  
<210> 541 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 8, 11, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 9, 10, 12, 13, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 541 
ccuagcgcgg cggacggcct t 21 
 
 
  
  
<210> 542 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 542 
ggccguccgc cgcgcuaggt t 21 
 
 
  
  
<210> 543 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 8, 10, 13, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 7, 9, 11, 12, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 543 
ggccuagcgc ggcggacggt t 21 
 
 
  
  
<210> 544 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 544 
ccguccgccg cgcuaggcct t 21 
 
 
  
  
<210> 545 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 6, 8, 11, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 5, 7, 9, 10, 12, 13, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 545 
ccuagcgcgg cggacggcct t 21 
 
 
  
  
<210> 546 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 546 
ggccguccgc cgcgcuaggt t 21 
 
 
  
  
<210> 547 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 7, 9, 12, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 5, 6, 8, 10, 11, 13, 14, 15, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 547 
gccuagcgcg gcggacggct t 21 
 
 
  
  
<210> 548 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 548 
gccguccgcc gcgcuaggct t 21 
 
 
  
  
<210> 549 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 5, 6, 8, 9, 11, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 7, 10, 12, 13, 14, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 549 
aaguucauca ugggcgacut t 21 
 
 
  
  
<210> 550 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 550 
agucgcccau gaugaacuut t 21 
 
 
  
  
<210> 551 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 9, 12, 13, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 10, 11, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 551 
gagcgacgcg gccuagcgct t 21 
 
 
  
  
<210> 552 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 552 
gcgcuaggcc gcgucgcuct t 21 
 
 
  
  
<210> 553 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 8, 9, 11, 12, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 10, 13, 14, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 553 
gaaaggcucg uuaaaaugut t 21 
 
 
  
  
<210> 554 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 2, 7 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 554 
acauuuuaac gagccuuuct t 21 
 
 
  
  
<210> 555 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 4, 5, 10, 12, 14, 15, 16, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 6, 7, 8, 9, 11, 13, 17, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 555 
ucguuaaaau gugcccagut t 21 
 
 
  
  
<210> 556 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 9, 14 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 556 
acugggcaca uuuuaacgat t 21 
 
 
  
  
<210> 557 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 5, 8, 9, 11, 12, 13, 15, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 3, 4, 6, 7, 10, 14, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 557 
ugggcggcua uuuaccaggt t 21 
 
 
  
  
<210> 558 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 10, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 558 
ccugguaaau agccgcccat t 21 
 
 
  
  
<210> 559 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 6, 9, 10, 12, 13, 14, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 3, 4, 5, 7, 8, 11, 15, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 559 
cugggcggcu auuuaccagt t 21 
 
 
  
  
<210> 560 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 5, 9, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 560 
cugguaaaua gccgcccagt t 21 
 
 
  
  
<210> 561 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 10, 11, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 9, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 561 
aaaggcucgu uaaaaugugt t 21 
 
 
  
  
<210> 562 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 562 
cacauuuuaa cgagccuuut t 21 
 
 
  
  
<210> 563 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 12, 14, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 8, 9, 10, 11, 13, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 563 
agguaccgag augucagcct t 21 
 
 
  
  
<210> 564 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 564 
ggcugacauc ucgguaccut t 21 
 
 
  
  
<210> 565 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 6, 7, 12, 14, 15, 18, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 8, 9, 10, 11, 13, 16, 17 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 565 
agguaccgag augucagcct t 21 
 
 
  
  
<210> 566 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 15 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 566 
ggcugacauc ucgguaccut t 21 
 
 
  
  
<210> 567 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 4, 7, 9, 12, 13, 14, 17, 19 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 6, 8, 10, 11, 15, 16, 18 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 567 
gagcgacgcg gccuagcgct t 21 
 
 
  
  
<210> 568 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1..19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 568 
gcgcuaggcc gcgucgcuct t 21 
 
 
  
  
<210> 569 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 6, 7, 8, 10, 11, 16, 18 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 9, 12, 13, 14, 15, 17, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 569 
aaaggcucgu uaaaaugugt t 21 
 
 
  
  
<210> 570 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 3, 8 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 570 
cacauuuuaa cgagccuuut t 21 
 
 
  
  
<210> 571 
<211> 38 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 571 
gcgtcgcgct cttagccttt ttctcttgga aagaaagt 38 
 
 
  
  
<210> 572 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 572 
cgtctgccgc tctaggcctt tttctcttgg aaagaaagt 39 
 
 
  
  
<210> 573 
<211> 37 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 573 
gcggctgctg cgcctctttt tctcttggaa agaaagt 37 
 
 
  
  
<210> 574 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 574 
tctccatgac gggccaggtt tttctcttgg aaagaaagt 39 
 
 
  
  
<210> 575 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 575 
tctgctcgaa ctccttttcc atttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 576 
<211> 39 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 576 
tcctggtaaa tggccgcctt tttctcttgg aaagaaagt 39 
 
 
  
  
<210> 577 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 577 
atttcggttt ttgttcttag gaagtttttc tcttggaaag aaagt 45 
 
 
  
  
<210> 578 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 578 
ccccgacccc tgcagctatt tttaggcata ggacccgtgt ct 42 
 
 
  
  
<210> 579 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 579 
ccgaggcccg ctgcaatttt ttaggcatag gacccgtgtc t 41 
 
 
  
  
<210> 580 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 580 
cttctcggcc cactgcgctt tttaggcata ggacccgtgt ct 42 
 
 
  
  
<210> 581 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 581 
cagctcccgg acttgtcgat ttttaggcat aggacccgtg tct 43 
 
 
  
  
<210> 582 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 582 
gtcactggct tcatgtcgga tatttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 583 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 583 
aagggactga cgtctctgta ccttttttag gcataggacc cgtgtct 47 
 
 
  
  
<210> 584 
<211> 50 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 584 
gatgtagttt aatccgacta tggtcatttt taggcatagg acccgtgtct  50 
 
 
  
  
<210> 585 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human PTP1B 
  
<400> 585 
cttggccact ctacatggga a 21 
 
 
  
  
<210> 586 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 586 
gaatttgcca tgggtggaat tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 587 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 587 
ggagggatct cgctcctgga tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 588 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 588 
ccccagcctt ctccatggtt ttttctcttg gaaagaaagt  40 
 
 
  
  
<210> 589 
<211> 40 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 589 
gctcccccct gcaaatgagt ttttctcttg gaaagaaagt  40 
 
 
  
  
<210> 590 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 590 
agccttgacg gtgccatgtt tttaggcata ggacccgtgt ct 42 
 
 
  
  
<210> 591 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 591 
gatgacaagc ttcccgttct ctttttaggc ataggacccg tgtct 45 
 
 
  
  
<210> 592 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 592 
agatggtgat gggatttcca tttttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 593 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 593 
gcatcgcccc acttgatttt tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 594 
<211> 43 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 594 
cacgacgtac tcagcgccat ttttaggcat aggacccgtg tct 43 
 
 
  
  
<210> 595 
<211> 46 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 595 
ggcagagatg atgacccttt tgtttttagg cataggaccc gtgtct 46 
 
 
  
  
<210> 596 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for human GAPDH 
  
<400> 596 
ggtgaagacg ccagtggact c 21 
 
 
  
  
<210> 597 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 597 
ggtttttgtt cttaggaagc ttcgtttttc tcttggaaag aaagt 45 
 
 
  
  
<210> 598 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 598 
tcattatctt cctggtgcaa ttttttttct cttggaaaga aagt 44 
 
 
  
  
<210> 599 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 599 
gctcctctgg gcttcttcca ttttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 600 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 600 
agggccctgg gtgagaatat atttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 601 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 601 
cgaactcctt ctccatctcc atgtttttag gcataggacc cgtgtct 47 
 
 
  
  
<210> 602 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 602 
cccagccttg tcgatctcct tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 603 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 603 
tggtaaatag ccgcccagtt tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 604 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 604 
ctggcttcat gtcgaatgtc ctttttaggc ataggacccg tgtct 45 
 
 
  
  
<210> 605 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 605 
gctgacatct cggtacctgt tcctttttag gcataggacc cgtgtct 47 
 
 
  
  
<210> 606 
<211> 45 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 606 
aatccgactg tggtcaaaag gtttttaggc ataggacccg tgtct 45 
 
 
  
  
<210> 607 
<211> 49 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 607 
ttttatcaag ctggcattga tatagttttt aggcatagga cccgtgtct 49 
 
 
  
  
<210> 608 
<211> 20 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat PTP1B 
  
<400> 608 
cgactttgca tgggaagtcg  20 
 
 
  

  
  
<210> 609 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 609 
ccagcttccc attctcagcc tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 610 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 610 
tctcgctcct ggaagatggt tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 611 
<211> 41 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 611 
cccatttgat gttagcggga tttttctctt ggaaagaaag t 41 
 
 
  
  
<210> 612 
<211> 42 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 612 
cggagatgat gacccttttg gtttttctct tggaaagaaa gt 42 
 
 
  
  
<210> 613 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 613 
gatgggtttc ccgttgatga tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 614 
<211> 47 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 614 
gacatactca gcaccagcat cactttttag gcataggacc cgtgtct 47 
 
 
  
  
<210> 615 
<211> 44 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 615 
cccagccttc tccatggtgg tttttaggca taggacccgt gtct 44 
 
 
  
  
<210> 616 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 616 
ttgactgtgc cgttgaactt g 21 
 
 
  
  
<210> 617 
<211> 22 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 617 
tgaagacgcc agtagactcc ac 22 
 
 
  
  
<210> 618 
<211> 19 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 618 
ccccaccctt caggtgagc 19 
 
 
  
  
<210> 619 
<211> 17 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: bDNA probes for rat GAPDH 
  
<400> 619 
ggcatcagcg gaagggg 17 
 
 
  
  
<210> 620 
<211> 3318 
<212> DNA 
<213> Homo sapiens 
  
<220>   
<223> cDNA sequence of human PTP1B 

<300>	 
<308>	NM_002827.2
<309>	2008-12-21

<400> 620 
gtgatgcgtagttccggctgccggttgacatgaagaagcagcagcggctagggcggcggt 60 
agctgcaggggtcggggattgcagcgggcctcggggctaagagcgcgacgcggcctagag 120 
cggcagacggcgcagtgggccgagaaggaggcgcagcagccgccctggcccgtcatggag 180 
atggaaaaggagttcgagcagatcgacaagtccgggagctgggcggccatttaccaggat 240 
atccgacatgaagccagtgacttcccatgtagagtggccaagcttcctaagaacaaaaac 300 
cgaaataggtacagagacgtcagtccctttgaccatagtcggattaaactacatcaagaa 360 
gataatgactatatcaacgctagtttgataaaaatggaagaagcccaaaggagttacatt 420 
cttacccagggccctttgcctaacacatgcggtcacttttgggagatggtgtgggagcag 480 
aaaagcaggggtgtcgtcatgctcaacagagtgatggagaaaggttcgttaaaatgcgca 540 
caatactggccacaaaaagaagaaaaagagatgatctttgaagacacaaatttgaaatta 600 
acattgatctctgaagatatcaagtcatattatacagtgcgacagctagaattggaaaac 660 
cttacaacccaagaaactcgagagatcttacatttccactataccacatggcctgacttt 720 
ggagtccctgaatcaccagcctcattcttgaactttcttttcaaagtccgagagtcaggg 780 
tcactcagcccggagcacgggcccgttgtggtgcactgcagtgcaggcatcggcaggtct 840 
ggaaccttctgtctggctgatacctgcctcttgctgatggacaagaggaaagacccttct 900 
tccgttgatatcaagaaagtgctgttagaaatgaggaagtttcggatggggctgatccag 960 
acagccgaccagctgcgcttctcctacctggctgtgatcgaaggtgccaaattcatcatg 1020 
ggggactcttccgtgcaggatcagtggaaggagctttcccacgaggacctggagccccca 1080 
cccgagcatatccccccacctccccggccacccaaacgaatcctggagccacacaatggg 1140 
aaatgcagggagttcttcccaaatcaccagtgggtgaaggaagagacccaggaggataaa 1200 
gactgccccatcaaggaagaaaaaggaagccccttaaatgccgcaccctacggcatcgaa 1260 
agcatgagtcaagacactgaagttagaagtcgggtcgtggggggaagtcttcgaggtgcc 1320 
caggctgcctccccagccaaaggggagccgtcactgcccgagaaggacgaggaccatgca 1380 
ctgagttactggaagcccttcctggtcaacatgtgcgtggctacggtcctcacggccggc 1440 
gcttacctctgctacaggttcctgttcaacagcaacacatagcctgaccctcctccactc 1500 
cacctccacccactgtccgcctctgcccgcagagcccacgcccgactagcaggcatgccg 1560 
cggtaggtaagggccgccggaccgcgtagagagccgggccccggacggacgttggttctg 1620 
cactaaaacccatcttccccggatgtgtgtctcacccctcatccttttactttttgcccc 1680 
ttccactttgagtaccaaatccacaagccattttttgaggagagtgaaagagagtaccat 1740 
gctggcggcgcagagggaaggggcctacacccgtcttggggctcgccccacccagggctc 1800 
cctcctggagcatcccaggcgggcggcacgccaacagccccccccttgaatctgcaggga 1860 
gcaactctccactccatatttatttaaacaattttttccccaaaggcatccatagtgcac 1920 
tagcattttcttgaaccaataatgtattaaaattttttgatgtcagccttgcatcaaggg 1980 
ctttatcaaaaagtacaataataaatcctcaggtagtactgggaatggaaggctttgcca 2040 
tgggcctgctgcgtcagaccagtactgggaaggaggacggttgtaagcagttgttattta 2100 
gtgatattgtgggtaacgtgagaagatagaacaatgctataatatataatgaacacgtgg 2160 
gtatttaataagaaacatgatgtgagattactttgtcccgcttattctcctccctgttat 2220 
ctgctagatctagttctcaatcactgctcccccgtgtgtattagaatgcatgtaaggtct 2280 
tcttgtgtcctgatgaaaaatatgtgcttgaaatgagaaactttgatctctgcttactaa 2340 
tgtgccccatgtccaagtccaacctgcctgtgcatgacctgatcattacatggctgtggt 2400 
tcctaagcctgttgctgaagtcattgtcgctcagcaatagggtgcagttttccaggaata 2460 
ggcatttgcctaattcctggcatgacactctagtgacttcctggtgaggcccagcctgtc 2520 
ctggtacagcagggtcttgctgtaactcagacattccaagggtatgggaagccatattca 2580 
cacctcacgctctggacatgatttagggaagcagggacaccccccgccccccacctttgg 2640 
gatcagcctccgccattccaagtcaacactcttcttgagcagaccgtgatttggaagaga 2700 
ggcacctgctggaaaccacacttcttgaaacagcctgggtgacggtcctttaggcagcct 2760 
gccgccgtctctgtcccggttcaccttgccgagagaggcgcgtctgccccaccctcaaac 2820 
cctgtggggcctgatggtgctcacgactcttcctgcaaagggaactgaagacctccacat 2880 
taagtggctttttaacatgaaaaacacggcagctgtagctcccgagctactctcttgcca 2940 
gcattttcacattttgcctttctcgtggtagaagccagtacagagaaattctgtggtggg 3000 
aacattcgaggtgtcaccctgcagagctatggtgaggtgtggataaggcttaggtgccag 3060 
gctgtaagcattctgagctgggcttgttgtttttaagtcctgtatatgtatgtagtagtt 3120 
tgggtgtgtatatatagtagcatttcaaaatggacgtactggtttaacctcctatccttg 3180 
gagagcagctggctctccaccttgttacacattatgttagagaggtagcgagctgctctg 3240 
ctatatgccttaagccaatatttactcatcaggtcattattttttacaatggccatggaa 3300 
taaaccatttttacaaaa                                           3318



  
<210> 621 
<211> 5092 
<212> DNA 
<213> Macaca mulatta 
  
<220>   
<223> Consensus cDNA sequence of rhesus monkey PTP1B  
  
<400> 621 
aggcgcggtgcgtagtccgccggttgacatgaagaagccgcggcggctagggcggcggta 60 
gcggcaggagtcggtgcttgctgcggacctcagggctaagagcgcgacgcggcctagagc 120 
ggcggactgcgcagtgggccgagaaggaggcgcagcagccgccctggcccgtcatggaga 180 
tggaaaaggagttcgagcagatcgacaagtccgggagctgggcggccatttaccaggata 240 
tccgacacgaagccagtgacttcccatgtagagtggccaagcttcctaagaacaaaaacc 300 
gaaataggtacagagacgtcagtccctttgaccatagtcggattaaactacatcaagaag 360 
ataacgactatatcaacgctagtttgataaaaatggaagaagcccaaaggagttacatcc 420 
ttacccagggccctttgcctaacacatgcggtcacttttgggagatggtgtgggaacaga 480 
aaagcaggggtgtcgtcatgctcaacagagtgatggagaaaggttcgttaaaatgcgcac 540 
agtactggccacaaaaagaagaaaaagaaatgatctttgaagacacaaacttgaaattaa 600 
cattgatctctgaagatatcaaatcatattatacagtgcgacagctagaattggaaaacc 660 
ttacaacccaagaaactcgagagatcttacatttccactataccacatggcctgactttg 720 
gagtccccgaatcgccagcctcattcttgaactttcttttcaaagtccgagagtcagggt 780 
cactcagcccggagcatgggcccgtcgtggtgcactgcagtgcgggtatcggcaggtctg 840 
ggaccttctgtctggctgatacctgcctcttgctgatggacaagaggaaagacccttctt 900 
ccgttgatatcaagaaagtgctattagaaatgaggaagtttcggatggggctgatccaga 960 
cagcagaccagctgcgcttctcctacttggctgtgatcgaaggtgccaaattcatcatgg 1020 
gggactcctctgtgcaggatcagtggaaggagctttcccacgaggacctggagcccccac 1080 
ccgagcacgtccccccacctccccggccacccaaacgaatcctggagccacacaatggga 1140 
aatgcagggagttcttcccaaatcaccagtgggtgaaggatgagacccaggaggataaag 1200 
actgccccatcaaggaagaaacaggaagccccttaaatgccgcaccctacagcatggaaa 1260 
gcatgagtcaagacactgaagttagaagtcgggtcgtggggggaagtcttcgaggtgccc 1320 
aggctgcctccctagccaaaggggagccgtcaccgcctaagaaggaggaggaccatgcac 1380 
tgagtcactggaagcccttcctggtcaacatgtgtgtggctacggtcctcacggccggcg 1440 
cgtacctctgctacagggtatgtttccactgacagacgcgctggcgagatgctcgtgtgc 1500 
agagagcactggccgctagcccgatggtaggattcagttctgtggcgcatctgagccagt 1560 
ctcagaagaaacagatcaaaggtttttaaagtctggaactgtggaagggctaacgagaat 1620 
taaggatcgatgcactggggttttaaggagccctctggtcccaagaatataagagtctaa 1680 
tctcagggccttaacctattcaggagtaagtagagaaaatgccaaatacgtctgtctctc 1740 
tctctctctcttttttttattcctttgtttttggaaaaaaatagaattacaacacattgt 1800 
tgtttttaacctttataaaaagcagctttttgttatttctggaaaaaaaacaaactaggc 1860 
acttaatgaaactttctcgtacccttaggtgatgtaattagctatataatttatatttga 1920 
tttcccagggaaggaatcccaaacttttacgaatgtaaactcccttggagaagagggtta 1980 
ggacgctcttgcgctcaagcccccctcagctgtgtgcacactgagccaggacagggtctt 2040 
tgagctttcccactgtaagaacagcaacacaaggccgtctagagaaacagaacctgcctc 2100 
tgcttctgctcagggtgtccgttgtcctttctccattgctccctcctgtgacagccatct 2160 
tgctcatgtaccagccctcatcaccccattcccataaaagagtgtcctcgaggcctctcc 2220 
ctgggggtcagaggtcaccacagggtggccctcagcatgtcagccctctgttaattcaga 2280 
ggagtgggctccacctcattgggagaagtgccatttcagcagaaatccacacgttagacg 2340 
tgtgttgctgttaagtaaggggaagagaggactagcctcagagctctggccatggaaatg 2400 
acctcctgagactttttcatcgttttaaatattttacctcttttcaggtggccatctgag 2460 
tacatcagatggttttgcaaaatgcaaacaattttttccttgggggtgatttttggggag 2520 
aaggggctactgtaaaaaataaaaccaaaaccccctttgctccctcggaggttgaagttg 2580 
ccggggggtgtggccggggtcgtgcatgaggcgacagctctgcgggtgcgggtctgggct 2640 
catctgaactgtttggtttcattccagttcctgttcaacagcaacacatagcctgaccct 2700 
cctccactccacctccacccactgtccgcctctgcccgcagagcccacgcccgactagca 2760 
ggcatgccgcggtaggtaagggccgccggaccgcgtagagagccgggccccggacggacg 2820 
ttggttctgcactaaaacccatcttccccggatgtgtgtctcacccctcatccttttact 2880 
ttttgccccttccactttgagtaccaaatccacaagccattttttgaggagagtgaaaga 2940 
gtaccatgctggcggcgcagagggagggggcctgcacctgtctggaggctcgccccaccc 3000 
agggctccctcctggagcatcccaggcaggtggtacaccaacagcccccttgactcgcag 3060 
ggagcaactctccactccatatttatttaaacaatttttccccaaaggtgtccatagtgc 3120 
actagcattttcttgaaccaataatgtattaaaaatttttgatgtcagccttgcatcaag 3180 
ggctttatcaaaaagtacaataataaatcctcaggtagtactgggaatggaagactttgc 3240 
catgggcctgctgcgtcagaccagtactgggaaggaggacggttgtaaggcagtcgttat 3300 
ttagtgatattgtgggtaacgtgagaagatagaacaatgctataatatataatgaacacg 3360 
tgggtatttaataagaaacatgatgtgagattactttgtcccgcttattctcctccctgt 3420 
tatctgctagatctagttctcaatcactgctcccccgtgtgtactagaatgcatgtaagg 3480 
tcttcttgtgtcctgatgaaaaatatgtgcttgaaatgagaaactttgatctctgcttac 3540 
taatgtgccccatgtccaagtccaacctgcctgtgcatgacctgatcattacatggctgt 3600 
ggttcctaagcctgttgctgaagtcgttgtcactcagcaatagggtgcagttttccagga 3660 
ataggcatttgcctcattcctggcctgacactctagtgacttcctggtgagacccggcct 3720 
gtcctggtgcagcagggtctcgctgtaactcagacattccaagggtatgggaagccatat 3780 
tcacacctcacgctctggacattatttaggcaagcagggacaccccccgccccccacctt 3840 
tgggatcagcctccgccattccaagtcagcactcttcttgagcagactgtgatttggaag 3900 
agaggcaactgctggaaaccacacttcttgaaacagcctgggtgacggtcctttaggcag 3960 
cctgccgccgtctccgtctgggttcaccttgccgagagaggcgcgtctgccccaccctcg 4020 
aaccctgtggggcctgatggtgctcacgactcttcctgcaaagggaactgaagacctcca 4080 
cattaagtggctttttaacaagaaaaacacggcagctgtagctcccgagctactctcttg 4140 
ccagcattttcacattttgcctttctcgtggtagaagccagtacagagaaattctgtcgt 4200 
gggaacattcgaggcatcaccccatagagctgtggtgaggtgtggataaggcttaggtgc 4260 
caggctgtaagcattctgagctgggcttgttgtttttaagtcctgtatatgtatgtagta 4320 
gtttgggtgtgtatatatagtagcatttcaaaatggacgtactggtttaacctcctatcc 4380 
tcggagagcagctggctctccaccttgttacacgtatgttagagaggtagcgagctgctc 4440 
tgctatatgccttaagccaatatttactcatcaggtcattattttttacaatggccatgg 4500 
aataaaccatttttacaaaaataaaaacaaaaaaagcaaggtgttttggtataatacctt 4560 
ttcaggtgtgtgtggatacgtggctgcatgaccgggtgggtgggggggcgtgtctcaggg 4620 
tcttctgtgacctcacagaactgtcagactgtacagttttccaacttgccatattcatga 4680 
tgggtttgcgttttagctgcaacaataaagttttttttctaaagaacgtgaatttggggt 4740 
gcttcccattttttttttctttgcttaattgagctaaaccaggatgagcaactcctgttt 4800 
ctttccatccctgctgatgtgaaacagatgttgtcaatcagctggggttagagttttcca 4860 
cttctaagaattaacctcagcatccccgcgttgccagcgccctcaggctggagcgctttc 4920 
cttgagggtgagcttactgaacaccttaggcctcagcccacttccttcccaaacccacgc 4980 
tttccatgtagagggcccttggataacttaacaaacttatcagtgttgtttgaagaacag 5040 
tgttttgagttgtaatctcaaaaccatgtcccttacccaattacctgtaaga         5092 
 
 
  
 
 
 
  
<210> 622 
<211> 1840 
<212> DNA 
<213> Macaca fascicularis 
  
<220>   
<223> cDNA sequence of cynomolgous monkey PTP1B (partial) 
  
<400> 622 
gatatccgacacgaagccagtgacttcccatgtagagtggccaagcttcctaagaacaaa 60 
aaccgaaataggtacagagacgtcagtccctataaaaatggaagaagcccaaaggagtta 120 
catccttacccagggccctttgcctaacacatgcggtcacttttgggagatggtgtggga 180 
acagaaaagcaggggtgtcgtcatgctcaacagagtgatggagaaaggttcgttaaaatg 240 
cgcacagtactggccacaaaaagaagaaaaagaaatgatctttgaagacacaaacttgaa 300 
attaacattgatctctgaagatatcaaatcatattatacagtgcgacagctagaattgga 360 
aaaccttacaacccaagaaactcgagagatcttacatttccactataccacatggcctga 420 
ctttggagtccccgaatcgccagcctcattcctgaactttcttttcaaagtccgagagtc 480 
agggtcactcagcccggagcatgggcccgtcgtggtgcactgcagtgcgggtatcgatta 540 
gaaatgaggaagtttcggatggggctgatccagacagcagaccagctgcgcttctcctac 600 
ttggctgtgatcgaaggtgccaaattcatcatgggggactcctctgtgcaggatcagtgg 660 
aaggagcttttcccacgaggacctggacgccccccacatgagtcaagacactgaagttag 720 
aagtcgggtcgtggggggaagtcttcgaggtgcccaggctgcctccctagccaaagggga 780 
gccgtcaccgcctaagaaggaggaggaccatgcactgagtcactggaagcccttcctggt 840 
caacatgtgtgtggctacggtcctcacggccggcgcgtacctctgctacagggtatgttt 900 
ccacgatatccgacacgaagccagtgacttcccatgtagagtggccaagcttcctaagaa 960 
caaaaaccgaaataggtacagagacgtcagtccctaagaagataacgactatatcaacgc 1020 
tagtttgataaaaatggaagaagcccaaaggagttacatccttacccagggccctttgcc 1080 
taacacatgcggtcacttttgggagatggtgtgggaacagaaaagcaggggtgtcgtcat 1140 
gctcaacagagtgatggagaaaggttcgttaaaatgcgcacagtactggccacaaaaaga 1200 
agaaaaagaaatgatctttgaagacacaaacttgaaattaacattgatctctgaagatat 1260 
caaatcatattatacagtgcgacagctagaattggaaaaccttacaacccaagaaactcg 1320 
agagatcttacatttccactataccacatggcctgactttggagtccccgaatcgccagc 1380 
ctcattcctgaactttcttttcaaagtccgagagtcagggtcactcagcccggagcatgg 1440 
gcccgtcgtggtgcactgcagtgcgggtatcgattagaaatgaggaagtttcggatgggg 1500 
ctgatccagacagcagaccagctgcgcttctcctacttggctgtgatcgaaggtgccaaa 1560 
ttcatcatgggggactcctctgtgcaggatcagtggaaggagcttttcccacgaggacct 1620 
ggacgccccccacatgagtcaagacactgaagttagaagtcgggtcgtggggggaagtct 1680 
tcgaggtgcccaggctgcctccctagccaaaggggagccgtcaccgcctaagaaggagga 1740 
ggaccatgcactgagtcactggaagcccttcctggtcaacatgtgtgtggctacggtcct 1800 
cacggccggcgcgtacctctgctacagggtatgtttccac                     1840 
 
 
  
  
  
<210> 623 
<211> 4213 
<212> DNA 
<213> Mus musculus 
  
<220>   
<223> cDNA sequence of mouse PTP1B 
  
<300>	 
<308>	NM_011201.3
<309>	2008-12-21

<400> 623
gcggtgaggcgggggtgcgtacttccggctgccggcttgacatgcagaagccgctgctgg 60 
ggagcttggggctgcggtggtggcgggtgacgggcttcgggacgcggagcgacgcggcct 120 
agcgcggcggacggccgtgggaactcgggcagccgacccgtcccgccatggagatggaga 180 
aggagttcgaggagatcgacaaggctgggaactgggcggctatttaccaggacattcgac 240 
atgaagccagcgacttcccatgcaaagtcgcgaagcttcctaagaacaaaaaccggaaca 300 
ggtaccgagatgtcagcccttttgaccacagtcggattaaattgcaccaggaagataatg 360 
actatatcaatgccagcttgataaaaatggaagaagcccagaggagctatattctcaccc 420 
agggccctttaccaaacacatgtgggcacttctgggagatggtgtgggagcagaagagca 480 
ggggcgtggtcatgctcaaccgcatcatggagaaaggctcgttaaaatgtgcccagtatt 540 
ggccacagcaagaagaaaaggagatggtctttgatgacacaggtttgaagttgacactaa 600 
tctctgaagatgtcaagtcatattacacagtacgacagttggagttggaaaacctgacta 660 
ccaaggagactcgagagatcctgcatttccactacaccacatggcctgactttggagtcc 720 
ccgagtcaccggcttctttcctcaatttccttttcaaagtccgagagtcaggctcactca 780 
gcctggagcatggccccattgtggtccactgcagcgccggcatcgggaggtcagggacct 840 
tctgtctggctgacacctgcctcttactgatggacaagaggaaagacccatcttccgtgg 900 
acatcaagaaagtactgctggagatgcgcaggttccgcatggggctcatccagactgccg 960 
accagctgcgcttctcctacctggctgtcatcgagggcgccaagttcatcatgggcgact 1020 
cgtcagtgcaggatcagtggaaggagctctcccgggaggatctagaccttccacccgagc 1080 
acgtgcccccacctccccggccacccaaacgcacactggagcctcacaacgggaagtgca 1140 
aggagctcttctccagccaccagtgggtgagcgaggagacctgtggggatgaagacagcc 1200 
tggccagagaggaaggcagagcccagtcaagtgccatgcacagcgtgagcagcatgagtc 1260 
cagacactgaagttaggagacggatggtgggtggaggtcttcaaagtgctcaggcgtctg 1320 
tccccaccgaggaagagctgtcctccactgaggaggaacacaaggcacattggccaagtc 1380 
actggaagcccttcctggtcaatgtgtgcatggccacgctcctggccaccggcgcgtact 1440 
tgtgctaccgggtgtgttttcactgacagactgggaggcactgccactgcccagcttagg 1500 
atgcggtctgcggcgtctgacctggtgtagagggaacaacaactcgcaagcctgctctgg 1560 
aactggaagggccagccccaggagggtattagtgcactgggctttgaaggagcccctggt 1620 
cccacgaacagagtctaatctcagggccttaacctgttcaggagaagtagaggaaatgcc 1680 
aaatactcttcttgctctcacctcactcctcccctttctctgattcatttgtttttggaa 1740 
aaaaaaaaaaaaagaattacaacacattgttgtttttaacatttataaaggcaggttttt 1800 
gttatttctggagaaaaaaaaaagatgctaggcactggtgagcttctctcgtgccctttg 1860 
gcatgtgatcagattcatgatttctattgatttccagtggaaggatcccgctgggcagga 1920 
ctgtaaagttcctgctggcgtgggcagcccccactgtgcacccggagcttgcaggtgccc 1980 
tggagccccatcctgttgtgaggagggcagccacatgggctgcctctgaacagcaagccc 2040 
ggctctgcttcgctcaggtgtcccccccgcggttccatccttctcggtctcctccctctt 2100 
tgtgagtgccatcttgcaaatggcccagcccttgccaccctatccctgtaaatccctgag 2160 
ggccttgcctcggggtcagaggtggctgccagcctaagtgctggggtttccatttcattt 2220 
ggaaagtcattactactctgtgtggaagccactctactgaggtgcaagcaagactggtga 2280 
aggagaaaggagccctggtgtcatggaagcccctcggcaggacctgtacccccctctgaa 2340 
acactgttccagtgaacgctctcgaaggcatcagatagaggatttttgcagactgcaaag 2400 
acttcctgagtggtgattttcagagtctggactcaaaaaacaccatggagcgcttaccgc 2460 
gctgccttccatgctggtatggctgaggccgtggggaggccggcgctgtggctccatcca 2520 
gtgcggatgcctttgtgcaatcgctgcccagcagcagagcctgcatgccagcctctgcgc 2580 
tgcaggccacaatggccatggcggcccaaagagtgagctgcgatggaggcttatcacatg 2640 
gagctgccttttcaggctatgcatctcccttcctgctttaccctctgcttccttcccgag 2700 
tagcaagcccaccatcatgaggagtgcaagggaggggcaggcattagagcggggtgcggc 2760 
tttcgaggtgaggccacctccgaggctgccctcctcttatttattcactttgcccggagg 2820 
tggcccccgcgtgagcatgccctgaaactgaccgtgtctgcctgcacccatgaccgtcag 2880 
gtcagtcctggggttgaggcatgagtgcaggactgacaggagccacagtatggccagtgc 2940 
tggggccaggagcaggagcaggagggtgtgaagagcagccttcaggagcataggacagtg 3000 
gtaatgcgcagagcccctgtggctgctcctgcgacgtgcagggtggaggctgggctttct 3060 
gcccacgaccttctagatcccattcccggcctctgctttccctgtgagttagaagataca 3120 
cagttctgtgctggtggcaccttgtgcttgacatgggaaacttagaagcctgctcactga 3180 
caggcacctcccgtgctctgaccggaagtggccgtcgctgagtaaccaccgccactcagt 3240 
gagagcagtgctgtccagtcaggtgccacctgactcctggcaggacacttcaggcttccg 3300 
tcctgccactccacgccacgccacgccatgccccgctggatctcagacattccacactca 3360 
cacctcattccctggacacttaggcaagcagggttcttccacctcttggatcagcccctc 3420 
cattccaagttcatgctgtcctggagcaggccaggactggaagcaaggcagcttgtgaga 3480 
agcaacctcctgggaacagtatggatgacagccttagagtcggcctgctgtcattgctgg 3540 
ccccagggccccttacccagaagtgtgcagctctccggcctgggagagacggatgacggt 3600 
gctcatgactcttctgggaggggaagaaccgagccttcacattgggtggctttttaaaat 3660 
aagcgaaggcagctggaactccgctgcctcgtgccagcatttcacattttgccttttacc 3720 
cagagaagccagcacagagccactggggaacagtgatagccttgcctgcagagcctgagg 3780 
aggtggcacagccagggtccaggctgggagcagttagcagtgggctgtgtctggagtagt 3840 
gtggtgtgtacagtagccttagaggtggctctcccggagaacaggcgctctctgccctgt 3900 
cgcccctgttggaggtagcaagctgctgtatgccttaagtcaacatttactcagcagggc 3960 
tctgtctctctctctctttgtctttctctctctctctctgtctctctctctctctaaatg 4020 
gccatagaataaaccatttttacaaaaataaaaaccaacaaaaaactgtgccctggaaga 4080 
gtacctttgcaggagtgtggggtgtctcagggtcttctgtgacctcacagagctgtctga 4140 
ctgcaccatttccaacttgctgtctcactaatgggtctgcattagttgcaacaataaatg 4200 
tttttaaagaaca                                                4213 
 
 
  
  
<210> 624 
<211> 1744 
<212> DNA 
<213> Rattus norvegicus 
  
<220>   
<223> cDNA sequence of rat PTP1B 

<300>	 
<308>	NM_012637.2
<309>	2008-12-21
  
<400> 624 
cgggcctcgagacgcggagcgacgcggcctagcgcggcggacggccgagggaactcgggc 60 
agtcgtcccgtcccgccatggaaatggagaaggaattcgagcagatcgataaggctggga 120 
actgggcggctatttaccaggatattcgacatgaagccagtgacttcccatgcagaatag 180 
cgaaacttcctaagaacaaaaaccggaacaggtaccgagatgtcagcccttttgaccaca 240 
gtcggattaaattgcatcaggaagataatgactatatcaatgccagcttgataaaaatgg 300 
aggaagcccagaggagctatatcctcacccagggccctttaccaaacacgtgcgggcact 360 
tctgggagatggtgtgggagcagaagagcaggggcgtggtcatgctcaaccgcatcatgg 420 
agaaaggctcgttaaaatgtgcccagtattggccacagaaagaagaaaaagagatggtct 480 
tcgatgacaccaatttgaagctgacactgatctctgaagatgtcaagtcatattacacag 540 
tacggcagttggagttggagaacctggctacccaggaggctcgagagatcctgcatttcc 600 
actacaccacctggcctgactttggagtccctgagtcacctgcctctttcctcaatttcc 660 
tattcaaagtccgagagtcaggctcactcagcccagagcacggccccattgtggtccact 720 
gcagtgctggcattggcaggtcagggaccttctgcctggctgacacctgcctcttactga 780 
tggacaagaggaaagacccgtcctctgtggacatcaagaaagtgctgttggagatgcgca 840 
ggttccgcatggggctcatccagacggccgaccaactgcgcttctcctacctggctgtga 900 
tcgagggtgcaaagttcatcatgggcgactcgtcagtgcaggatcagtggaaggagcttt 960 
cccatgaagacctggagcctccccctgagcacgtgcccccacctccccggccacccaaac 1020 
gcacattggagcctcacaatggcaagtgcaaggagctcttctccaaccaccagtgggtga 1080 
gcgaggagagctgtgaggatgaggacatcctggccagagaggaaagcagagccccctcaa 1140 
ttgctgtgcacagcatgagcagtatgagtcaagacactgaagttaggaaacggatggtgg 1200 
gtggaggtcttcaaagtgctcaggcatctgtccccactgaggaagagctgtccccaaccg 1260 
aggaggaacaaaaggcacacaggccagttcactggaagcccttcctggtcaacgtgtgca 1320 
tggccacggccctggcgactggcgcgtacctctgttaccgggtatgttttcactgacaga 1380 
ctgctgtgaggcatgagcgtggtgggcgctgccactgcccaggttaggatttggtctgcg 1440 
gcgtctaacctggtgtagaagaaacaacagcttacaagcctgtggtggaactggaagggc 1500 
cagccccaggaggggcatctgtgcactgggctttgaaggagcccctggtcccaagaacag 1560 
agtctaatctcagggccttaacctgttcaggagaagtagaggaaatgccaaatactcttc 1620 
ttgctctcacctcactcctcccctttctctggttcgtttgtttttggaaaaaaaaaaaaa 1680 
gaattacaacacattgttgtttttaacatttataaaaaaaaaaaaaaaaaaaaaaaaaaa 1740 
aaaa                                                         1744 




  
<210> 625 
<211> 20
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: primer for psiCHECK insert 
  
<400> 625 
tgtccgcaac tacaacgcct  20 



<210> 626 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 5, 7, 8, 12, 14, 15, 16, 17 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 4, 6, 9, 10, 11, 13, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 626 
cuuacgcuga guacuucgat t 21 
 


<210> 627 
<211> 21 
<212> DNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<220>   
<221> modified_base 
<222> 1 
<223> /mod_base = "nucleoside: lacks 5'-phosphate group" 
  
<220>   
<221> modified_base 
<222> 7, 11, 16 
<223> /mod_base = "2'-O-methyl corresponding nucleoside" 
  
<220>   
<221> modified_base 
<222> 21 
<223> /mod_base = "5'-phosphorothioate thymidine" 
  
<220>   
<221> modified_base 
<222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 
<223> /mod_base = "2'-hydroxy corresponding nucleoside" 
  
<400> 627 
ucgaaguacu cagcguaagt t 21 
 


<210> 628 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 628 
augcauguaa ggucuucuu 19 
 
 
<210> 629 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 629 
aagaagaccu uacaugcau 19 
 
 
<210> 630 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 630 
aaacucgaga gaucuuaca 19 
 
 
<210> 631 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 631 
uguaagaucu cucgaguuu 19 
 
 
<210> 632 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 632 
ugauggagaa agguucguu 19 
 
 
<210> 633 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 633 
aacgaaccuu ucuccauca 19 
 
 
<210> 634 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 634 
ggagaaaggu ucguuaaaa 19 
 
 
<210> 635 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 635 
uuuuaacgaa ccuuucucc 19 
 
 
<210> 636 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 636 
aaaugaggaa guuucggau 19 
 
 
<210> 637 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 637 
auccgaaacu uccucauuu 19 
 
 
<210> 638 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 638 
auaucaacgc uaguuugau 19 
 
 
<210> 639 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 639 
aucaaacuag cguugauau 19 
 
 
<210> 640 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 640 
cacugaaguu agaagucgg 19 
 
 
<210> 641 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 641 
ccgacuucua acuucagug 19 
 
 
<210> 642 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 642 
cccuucuucc guugauauc 19 
 
 
<210> 643 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 643 
gauaucaacg gaagaaggg 19 
 
 
<210> 644 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 644 
ucgucaugcu caacagagu 19 
 
 
<210> 645 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 645 
acucuguuga gcaugacga 19 
 
 
<210> 646 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 646 
gauggagaaa gguucguua 19 
 
 
<210> 647 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 647 
uaacgaaccu uucuccauc 19 
 
 
<210> 648 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 648 
gaucuuacau uuccacuau 19 
 
 
<210> 649 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 649 
auaguggaaa uguaagauc 19 
 
 
<210> 650 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 650 
ucccuuugac cauagucgg 19 
 
 
<210> 651 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 651 
ccgacuaugg ucaaaggga 19 
 
 
<210> 652 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 652 
auagucggau uaaacuaca 19 
 
 
<210> 653 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 653 
uguaguuuaa uccgacuau 19 
 
 
<210> 654 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 654 
cuaguucuca aucacugcu 19 
 
 
<210> 655 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 655 
agcagugauu gagaacuag 19 
 
 
<210> 656 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 656 
cuagaucuag uucucaauc 19 
 
 
<210> 657 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 657 
gauugagaac uagaucuag 19 
 
 
<210> 658 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 658 
gaaguuagaa gucgggucg 19 
 
 
<210> 659 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 659 
cgacccgacu ucuaacuuc 19 
 
 
<210> 660 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 660 
cguacugguu uaaccuccu 19 
 
 
<210> 661 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 661 
aggagguuaa accaguacg 19 
 
 
<210> 662 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 662 
auuucaaaau ggacguacu 19 
 
 
<210> 663 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 663 
aguacgucca uuuugaaau 19 
 
 
<210> 664 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 664 
gaaugcaugu aaggucuuc 19 
 
 
<210> 665 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 665 
gaagaccuua caugcauuc 19 
 
 
<210> 666 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 666 
caugauguga gauuacuuu 19 
 
 
<210> 667 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 667 
aaaguaaucu cacaucaug 19 
 
 
<210> 668 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 668 
gguacagaga cgucagucc 19 
 
 
<210> 669 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 669 
ggacugacgu cucuguacc 19 
 
 
<210> 670 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 670 
uauuauacag ugcgacagc 19 
 
 
<210> 671 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 671 
gcugucgcac uguauaaua 19 
 
 
<210> 672 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 672 
auguuagaga gguagcgag 19 
 
 
<210> 673 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 673 
cucgcuaccu cucuaacau 19 
 
 
<210> 674 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 674 
ugcuauaugc cuuaagcca 19 
 
 
<210> 675 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 675 
uggcuuaagg cauauagca 19 
 
 
<210> 676 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 676 
ccuuaagcca auauuuacu 19 
 
 
<210> 677 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 677 
aguaaauauu ggcuuaagg 19 
 
 
<210> 678 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 678 
uuucaaaguc cgagaguca 19 
 
 
<210> 679 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 679 
ugacucucgg acuuugaaa 19 
 
 
<210> 680 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 680 
guuagagagg uagcgagcu 19 
 
 
<210> 681 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 681 
agcucgcuac cucucuaac 19 
 
 
<210> 682 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 682 
cacccaaacg aauccugga 19 
 
 
<210> 683 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 683 
uccaggauuc guuugggug 19 
 
 
<210> 684 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 684 
gacccuucuu ccguugaua 19 
 
 
<210> 685 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 685 
uaucaacgga agaaggguc 19 
 
 
<210> 686 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 686 
guacagagac gucaguccc 19 
 
 
<210> 687 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 687 
gggacugacg ucucuguac 19 
 
 
<210> 688 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 688 
acguacuggu uuaaccucc 19 
 
 
<210> 689 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 689 
ggagguuaaa ccaguacgu 19 
 
 
<210> 690 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 690 
cccuguuauc ugcuagauc 19 
 
 
<210> 691 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 691 
gaucuagcag auaacaggg 19 
 
 
<210> 692 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 692 
cucagacauu ccaagggua 19 
 
 
<210> 693 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 693 
uacccuugga augucugag 19 
 
 
<210> 694 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 694 
ccggacggac guugguucu 19 
 
 
<210> 695 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 695 
agaaccaacg uccguccgg 19 
 
 
<210> 696 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 696 
ugcgacagcu agaauugga 19 
 
 
<210> 697 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 697 
uccaauucua gcugucgca 19 
 
 
<210> 698 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 698 
acguggguau uuaauaaga 19 
 
 
<210> 699 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 699 
ucuuauuaaa uacccacgu 19 
 
 
<210> 700 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 700 
ugaccauagu cggauuaaa 19 
 
 
<210> 701 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 701 
uuuaauccga cuaugguca 19 
 
 
<210> 702 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 702 
uaucaacgcu aguuugaua 19 
 
 
<210> 703 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 703 
uaucaaacua gcguugaua 19 
 
 
<210> 704 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 704 
cuuuucaaag uccgagagu 19 
 
 
<210> 705 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 705 
acucucggac uuugaaaag 19 
 
 
<210> 706 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 706 
cacuauacca cauggccug 19 
 
 
<210> 707 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 707 
caggccaugu gguauagug 19 
 
 
<210> 708 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 708 
accugaucau uacauggcu 19 
 
 
<210> 709 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 709 
agccauguaa ugaucaggu 19 
 
 
<210> 710 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 710 
cagugacuuc ccauguaga 19 
 
 
<210> 711 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 711 
ucuacauggg aagucacug 19 
 
 
<210> 712 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 712 
gagauuacuu ugucccgcu 19 
 
 
<210> 713 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 713 
agcgggacaa aguaaucuc 19 
 
 
<210> 714 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 714 
ucaacgcuag uuugauaaa 19 
 
 
<210> 715 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 715 
uuuaucaaac uagcguuga 19 
 
 
<210> 716 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 716 
cauauuauac agugcgaca 19 
 
 
<210> 717 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 717 
ugucgcacug uauaauaug 19 
 
 
<210> 718 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 718 
uauguuagag agguagcga 19 
 
 
<210> 719 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 719 
ucgcuaccuc ucuaacaua 19 
 
 
<210> 720 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 720 
ccauagugca cuagcauuu 19 
 
 
<210> 721 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 721 
aaaugcuagu gcacuaugg 19 
 
 
<210> 722 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 722 
uugccuuucu cgugguaga 19 
 
 
<210> 723 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 723 
ucuaccacga gaaaggcaa 19 
 
 
<210> 724 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 724 
uaugccuuaa gccaauauu 19 
 
 
<210> 725 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 725 
aauauuggcu uaaggcaua 19 
 
 
<210> 726 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 726 
ccauagucgg auuaaacua 19 
 
 
<210> 727 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 727 
uaguuuaauc cgacuaugg 19 
 
 
<210> 728 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 728 
acccuucuuc cguugauau 19 
 
 
<210> 729 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 729 
auaucaacgg aagaagggu 19 
 
 
<210> 730 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 730 
auagguacag agacgucag 19 
 
 
<210> 731 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 731 
cugacgucuc uguaccuau 19 
 
 
<210> 732 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 732 
ucuuuucaaa guccgagag 19 
 
 
<210> 733 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 733 
cucucggacu uugaaaaga 19 
 
 
<210> 734 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 734 
uccauagugc acuagcauu 19 
 
 
<210> 735 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 735 
aaugcuagug cacuaugga 19 
 
 
<210> 736 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 736 
ugauauugug gguaacgug 19 
 
 
<210> 737 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 737 
cacguuaccc acaauauca 19 
 
 
<210> 738 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 738 
uuuaccagga uauccgaca 19 
 
 
<210> 739 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 739 
ugucggauau ccugguaaa 19 
 
 
<210> 740 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 740 
uuuucaaagu ccgagaguc 19 
 
 
<210> 741 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 741 
gacucucgga cuuugaaaa 19 
 
 
<210> 742 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 742 
cugaaguuag aagucgggu 19 
 
 
<210> 743 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 743 
acccgacuuc uaacuucag 19 
 
 
<210> 744 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 744 
uuugaguacc aaauccaca 19 
 
 
<210> 745 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 745 
uguggauuug guacucaaa 19 
 
 
<210> 746 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 746 
aaggguaugg gaagccaua 19 
 
 
<210> 747 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 747 
uauggcuucc cauacccuu 19 
 
 
<210> 748 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 748 
uaacacaugc ggucacuuu 19 
 
 
<210> 749 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 749 
aaagugaccg cauguguua 19 
 
 
<210> 750 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 750 
auggccaugg aauaaacca 19 
 
 
<210> 751 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 751 
ugguuuauuc cauggccau 19 
 
 
<210> 752 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 752 
uucuuccguu gauaucaag 19 
 
 
<210> 753 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 753 
cuugauauca acggaagaa 19 
 
 
<210> 754 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 754 
gugauauugu ggguaacgu 19 
 
 
<210> 755 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 755 
acguuaccca caauaucac 19 
 
 
<210> 756 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 756 
uacucaucag gucauuauu 19 
 
 
<210> 757 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 757 
aauaaugacc ugaugagua 19 
 
 
<210> 758 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 758 
uguggguaac gugagaaga 19 
 
 
<210> 759 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 759 
ucuucucacg uuacccaca 19 
 
 
<210> 760 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 760 
aacucgagag aucuuacau 19 
 
 
<210> 761 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 761 
auguaagauc ucucgaguu 19 
 
 
<210> 762 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 762 
ugcaugaccu gaucauuac 19 
 
 
<210> 763 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 763 
guaaugauca ggucaugca 19 
 
 
<210> 764 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 764 
guaguaguuu gggugugua 19 
 
 
<210> 765 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 765 
uacacaccca aacuacuac 19 
 
 
<210> 766 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 766 
cugguuuaac cuccuaucc 19 
 
 
<210> 767 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 767 
ggauaggagg uuaaaccag 19 
 
 
<210> 768 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 768 
auugugggua acgugagaa 19 
 
 
<210> 769 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 769 
uucucacguu acccacaau 19 
 
 
<210> 770 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 770 
uuagagaggu agcgagcug 19 
 
 
<210> 771 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 771 
cagcucgcua ccucucuaa 19 
 
 
<210> 772 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 772 
agugauauug uggguaacg 19 
 
 
<210> 773 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 773 
cguuacccac aauaucacu 19 
 
 
<210> 774 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 774 
uucuuuucaa aguccgaga 19 
 
 
<210> 775 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 775 
ucucggacuu ugaaaagaa 19 
 
 
<210> 776 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 776 
auggagaaag guucguuaa 19 
 
 
<210> 777 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 777 
uuaacgaacc uuucuccau 19 
 
 
<210> 778 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 778 
acucgagaga ucuuacauu 19 
 
 
<210> 779 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 779 
aauguaagau cucucgagu 19 
 
 
<210> 780 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 780 
ugcuagaucu aguucucaa 19 
 
 
<210> 781 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 781 
uugagaacua gaucuagca 19 
 
 
<210> 782 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 782 
ccuaacacau gcggucacu 19 
 
 
<210> 783 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 783 
agugaccgca uguguuagg 19 
 
 
<210> 784 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 784 
ggacguacug guuuaaccu 19 
 
 
<210> 785 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 785 
agguuaaacc aguacgucc 19 
 
 
<210> 786 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 786 
uuuacucauc aggucauua 19 
 
 
<210> 787 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 787 
uaaugaccug augaguaaa 19 
 
 
<210> 788 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 788 
gauuacuuug ucccgcuua 19 
 
 
<210> 789 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 789 
uaagcgggac aaaguaauc 19 
 
 
<210> 790 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 790 
uuagaagucg ggucguggg 19 
 
 
<210> 791 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 791 
cccacgaccc gacuucuaa 19 
 
 
<210> 792 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 792 
cuagcaggca ugccgcggu 19 
 
 
<210> 793 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 793 
accgcggcau gccugcuag 19 
 
 
<210> 794 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 794 
gauauugugg guaacguga 19 
 
 
<210> 795 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 795 
ucacguuacc cacaauauc 19 
 
 
<210> 796 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 796 
ucauauuaua cagugcgac 19 
 
 
<210> 797 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 797 
gucgcacugu auaauauga 19 
 
 
<210> 798 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 798 
gccuuucucg ugguagaag 19 
 
 
<210> 799 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 799 
cuucuaccac gagaaaggc 19 
 
 
<210> 800 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 800 
uugccuaaca caugcgguc 19 
 
 
<210> 801 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 801 
gaccgcaugu guuaggcaa 19 
 
 
<210> 802 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 802 
ucgaaggugc caaauucau 19 
 
 
<210> 803 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 803 
augaauuugg caccuucga 19 
 
 
<210> 804 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 804 
auauaaugaa cacgugggu 19 
 
 
<210> 805 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 805 
acccacgugu ucauuauau 19 
 
 
<210> 806 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 806 
accauagucg gauuaaacu 19 
 
 
<210> 807 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 807 
aguuuaaucc gacuauggu 19 
 
 
<210> 808 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 808 
uaugggaagc cauauucac 19 
 
 
<210> 809 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 809 
gugaauaugg cuucccaua 19 
 
 
<210> 810 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 810 
cacauuuugc cuuucucgu 19 
 
 
<210> 811 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 811 
acgagaaagg caaaaugug 19 
 
 
<210> 812 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 812 
gaucuaguuc ucaaucacu 19 
 
 
<210> 813 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 813 
agugauugag aacuagauc 19 
 
 
<210> 814 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 814 
ugaccugauc auuacaugg 19 
 
 
<210> 815 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 815 
ccauguaaug aucagguca 19 
 
 
<210> 816 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 816 
cauauucaca ccucacgcu 19 
 
 
<210> 817 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 817 
agcgugaggu gugaauaug 19 
 
 
<210> 818 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 818 
gugagauuac uuugucccg 19 
 
 
<210> 819 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 819 
cgggacaaag uaaucucac 19 
 
 
<210> 820 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 820 
cagaucgaca aguccggga 19 
 
 
<210> 821 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 821 
ucccggacuu gucgaucug 19 
 
 
<210> 822 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 822 
ugguuuaacc uccuauccu 19 
 
 
<210> 823 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 823 
aggauaggag guuaaacca 19 
 
 
<210> 824 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 824 
aagcuuccua agaacaaaa 19 
 
 
<210> 825 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 825 
uuuuguucuu aggaagcuu 19 
 
 
<210> 826 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 826 
cauuucaaaa uggacguac 19 
 
 
<210> 827 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 827 
guacguccau uuugaaaug 19 
 
 
<210> 828 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 828 
ccuccacauu aaguggcuu 19 
 
 
<210> 829 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 829 
aagccacuua auguggagg 19 
 
 
<210> 830 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 830 
acagugcgac agcuagaau 19 
 
 
<210> 831 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 831 
auucuagcug ucgcacugu 19 
 
 
<210> 832 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 832 
ugugagauua cuuuguccc 19 
 
 
<210> 833 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 833 
gggacaaagu aaucucaca 19 
 
 
<210> 834 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 834 
cuuugaccau agucggauu 19 
 
 
<210> 835 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 835 
aauccgacua uggucaaag 19 
 
 
<210> 836 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 836 
aucugcuaga ucuaguucu 19 
 
 
<210> 837 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 837 
agaacuagau cuagcagau 19 
 
 
<210> 838 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 838 
gacggacguu gguucugca 19 
 
 
<210> 839 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 839 
ugcagaacca acguccguc 19 
 
 
<210> 840 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 840 
gguucguuaa aaugcgcac 19 
 
 
<210> 841 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 841 
gugcgcauuu uaacgaacc 19 
 
 
<210> 842 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 842 
cugcuauaug ccuuaagcc 19 
 
 
<210> 843 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 843 
ggcuuaaggc auauagcag 19 
 
 
<210> 844 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 844 
uuucaaaaug gacguacug 19 
 
 
<210> 845 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 845 
caguacgucc auuuugaaa 19 
 
 
<210> 846 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 846 
uauaugccuu aagccaaua 19 
 
 
<210> 847 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 847 
uauuggcuua aggcauaua 19 
 
 
<210> 848 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 848 
gaccauaguc ggauuaaac 19 
 
 
<210> 849 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 849 
guuuaauccg acuaugguc 19 
 
 
<210> 850 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 850 
uacaacccaa gaaacucga 19 
 
 
<210> 851 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 851 
ucgaguuucu uggguugua 19 
 
 
<210> 852 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 852 
cuaacacaug cggucacuu 19 
 
 
<210> 853 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 853 
aagugaccgc auguguuag 19 
 
 
<210> 854 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 854 
ccggccaccc aaacgaauc 19 
 
 
<210> 855 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 855 
gauucguuug gguggccgg 19 
 
 
<210> 856 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 856 
gcgagcugcu cugcuauau 19 
 
 
<210> 857 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 857 
auauagcaga gcagcucgc 19 
 
 
<210> 858 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 858 
auuacuuugu cccgcuuau 19 
 
 
<210> 859 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 859 
auaagcggga caaaguaau 19 
 
 
<210> 860 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 860 
ccauauucac accucacgc 19 
 
 
<210> 861 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 861 
gcgugaggug ugaauaugg 19 
 
 
<210> 862 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 862 
acucaucagg ucauuauuu 19 
 
 
<210> 863 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 863 
aaauaaugac cugaugagu 19 
 
 
<210> 864 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 864 
auggugcuca cgacucuuc 19 
 
 
<210> 865 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 865 
gaagagucgu gagcaccau 19 
 
 
<210> 866 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 866 
ucugcuuacu aaugugccc 19 
 
 
<210> 867 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 867 
gggcacauua guaagcaga 19 
 
 
<210> 868 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 868 
agauuacuuu gucccgcuu 19 
 
 
<210> 869 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 869 
aagcgggaca aaguaaucu 19 
 
 
<210> 870 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 870 
aucgacaagu ccgggagcu 19 
 
 
<210> 871 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 871 
agcucccgga cuugucgau 19 
 
 
<210> 872 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 872 
gcaacucucc acuccauau 19 
 
 
<210> 873 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 873 
auauggagug gagaguugc 19 
 
 
<210> 874 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 874 
ucgagagauc uuacauuuc 19 
 
 
<210> 875 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 875 
gaaauguaag aucucucga 19 
 
 
<210> 876 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 876 
ccgacuagca ggcaugccg 19 
 
 
<210> 877 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 877 
cggcaugccu gcuagucgg 19 
 
 
<210> 878 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 878 
ugagauuacu uugucccgc 19 
 
 
<210> 879 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 879 
gcgggacaaa guaaucuca 19 
 
 
<210> 880 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 880 
gucggauuaa acuacauca 19 
 
 
<210> 881 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 881 
ugauguaguu uaauccgac 19 
 
 
<210> 882 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 882 
gccuaacaca ugcggucac 19 
 
 
<210> 883 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 883 
gugaccgcau guguuaggc 19 
 
 
<210> 884 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 884 
auuuacucau caggucauu 19 
 
 
<210> 885 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 885 
aaugaccuga ugaguaaau 19 
 
 
<210> 886 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 886 
agagguagcg agcugcucu 19 
 
 
<210> 887 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 887 
agagcagcuc gcuaccucu 19 
 
 
<210> 888 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 888 
gguaguacug ggaauggaa 19 
 
 
<210> 889 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 889 
uuccauuccc aguacuacc 19 
 
 
<210> 890 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 890 
auucacaccu cacgcucug 19 
 
 
<210> 891 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 891 
cagagcguga ggugugaau 19 
 
 
<210> 892 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 892 
aacacaugcg gucacuuuu 19 
 
 
<210> 893 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 893 
aaaagugacc gcauguguu 19 
 
 
<210> 894 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 894 
gcugcgucag accaguacu 19 
 
 
<210> 895 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 895 
aguacugguc ugacgcagc 19 
 
 
<210> 896 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 896 
auccuggagc cacacaaug 19 
 
 
<210> 897 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 897 
cauugugugg cuccaggau 19 
 
 
<210> 898 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 898 
cucccgagcu acucucuug 19 
 
 
<210> 899 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 899 
caagagagua gcucgggag 19 
 
 
<210> 900 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 900 
uuaggugcca ggcuguaag 19 
 
 
<210> 901 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 901 
cuuacagccu ggcaccuaa 19 
 
 
<210> 902 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 902 
gccuggguga cgguccuuu 19 
 
 
<210> 903 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 903 
aaaggaccgu cacccaggc 19 
 
 
<210> 904 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 904 
aguuagaagu cgggucgug 19 
 
 
<210> 905 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 905 
cacgacccga cuucuaacu 19 
 
 
<210> 906 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 906 
gaaagacccu ucuuccguu 19 
 
 
<210> 907 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 907 
aacggaagaa gggucuuuc 19 
 
 
<210> 908 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 908 
acacaugcgg ucacuuuug 19 
 
 
<210> 909 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 909 
caaaagugac cgcaugugu 19 
 
 
<210> 910 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 910 
uucaaaaugg acguacugg 19 
 
 
<210> 911 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 911 
ccaguacguc cauuuugaa 19 
 
 
<210> 912 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 912 
ccuuugacca uagucggau 19 
 
 
<210> 913 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 913 
auccgacuau ggucaaagg 19 
 
 
<210> 914 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 914 
ggaguucuuc ccaaaucac 19 
 
 
<210> 915 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 915 
gugauuuggg aagaacucc 19 
 
 
<210> 916 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 916 
auuuaccagg auauccgac 19 
 
 
<210> 917 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 917 
gucggauauc cugguaaau 19 
 
 
<210> 918 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 918 
ugaaguuaga agucggguc 19 
 
 
<210> 919 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 919 
gacccgacuu cuaacuuca 19 
 
 
<210> 920 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 920 
uccacuauac cacauggcc 19 
 
 
<210> 921 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 921 
ggccaugugg uauagugga 19 
 
 
<210> 922 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 922 
gugauggaga aagguucgu 19 
 
 
<210> 923 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 923 
acgaaccuuu cuccaucac 19 
 
 
<210> 924 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 924 
gugaggugug gauaaggcu 19 
 
 
<210> 925 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 925 
agccuuaucc acaccucac 19 
 
 
<210> 926 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 926 
gucagccuug caucaaggg 19 
 
 
<210> 927 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 927 
cccuugaugc aaggcugac 19 
 
 
<210> 928 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 928 
gugacggucc uuuaggcag 19 
 
 
<210> 929 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 929 
cugccuaaag gaccgucac 19 
 
 
<210> 930 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 930 
uauaccacau ggccugacu 19 
 
 
<210> 931 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 931 
agucaggcca ugugguaua 19 
 
 
<210> 932 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 932 
uauucacacc ucacgcucu 19 
 
 
<210> 933 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 933 
agagcgugag gugugaaua 19 
 
 
<210> 934 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 934 
ggugacgguc cuuuaggca 19 
 
 
<210> 935 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 935 
ugccuaaagg accgucacc 19 
 
 
<210> 936 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 936 
augucagccu ugcaucaag 19 
 
 
<210> 937 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 937 
cuugaugcaa ggcugacau 19 
 
 
<210> 938 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 938 
gcuaagagcg cgacgcggc 19 
 
 
<210> 939 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 939 
gccgcgucgc gcucuuagc 19 
 
 
<210> 940 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 940 
uuccacuaua ccacauggc 19 
 
 
<210> 941 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 941 
gccauguggu auaguggaa 19 
 
 
<210> 942 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 942 
auauuauaca gugcgacag 19 
 
 
<210> 943 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 943 
cugucgcacu guauaauau 19 
 
 
<210> 944 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 944 
agucggauua aacuacauc 19 
 
 
<210> 945 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 945 
gauguaguuu aauccgacu 19 
 
 
<210> 946 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 946 
agaucuuaca uuuccacua 19 
 
 
<210> 947 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 947 
uaguggaaau guaagaucu 19 
 
 
<210> 948 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 948 
gauggugcuc acgacucuu 19 
 
 
<210> 949 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 949 
aagagucgug agcaccauc 19 
 
 
<210> 950 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 950 
ccuuuaggca gccugccgc 19 
 
 
<210> 951 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 951 
gcggcaggcu gccuaaagg 19 
 
 
<210> 952 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 952 
gaccuccaca uuaaguggc 19 
 
 
<210> 953 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 953 
gccacuuaau guggagguc 19 
 
 
<210> 954 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 954 
uuauucuccu cccuguuau 19 
 
 
<210> 955 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 955 
auaacaggga ggagaauaa 19 
 
 
<210> 956 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 956 
gacguacugg uuuaaccuc 19 
 
 
<210> 957 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 957 
gagguuaaac caguacguc 19 
 
 
<210> 958 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 958 
gaaggagcuu ucccacgag 19 
 
 
<210> 959 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 959 
cucgugggaa agcuccuuc 19 
 
 
<210> 960 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 960 
gaaaaccuua caacccaag 19 
 
 
<210> 961 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 961 
cuuggguugu aagguuuuc 19 
 
 
<210> 962 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 962 
uaaauccuca gguaguacu 19 
 
 
<210> 963 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 963 
aguacuaccu gaggauuua 19 
 
 
<210> 964 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 964 
ggaucagccu ccgccauuc 19 
 
 
<210> 965 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 965 
gaauggcgga ggcugaucc 19 
 
 
<210> 966 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 966 
gguucaccuu gccgagaga 19 
 
 
<210> 967 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 967 
ucucucggca aggugaacc 19 
 
 
<210> 968 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 968 
ugauggugcu cacgacucu 19 
 
 
<210> 969 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 969 
agagucguga gcaccauca 19 
 
 
<210> 970 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 970 
uacauuucca cuauaccac 19 
 
 
<210> 971 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 971 
gugguauagu ggaaaugua 19 
 
 
<210> 972 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 972 
uacugguuua accuccuau 19 
 
 
<210> 973 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 973 
auaggagguu aaaccagua 19 
 
 
<210> 974 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 974 
gcagaucgac aaguccggg 19 
 
 
<210> 975 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 975 
cccggacuug ucgaucugc 19 
 
 
<210> 976 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 976 
gcaggcaugc cgcgguagg 19 
 
 
<210> 977 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 977 
ccuaccgcgg caugccugc 19 
 
 
<210> 978 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 978 
gcaugccgcg guagguaag 19 
 
 
<210> 979 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 979 
cuuaccuacc gcggcaugc 19 
 
 
<210> 980 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 980 
uugaccauag ucggauuaa 19 
 
 
<210> 981 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 981 
uuaauccgac uauggucaa 19 
 
 
<210> 982 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 982 
auaccacaug gccugacuu 19 
 
 
<210> 983 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 983 
aagucaggcc augugguau 19 
 
 
<210> 984 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 984 
uuugaccaua gucggauua 19 
 
 
<210> 985 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 985 
uaauccgacu auggucaaa 19 
 
 
<210> 986 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 986 
aaagacccuu cuuccguug 19 
 
 
<210> 987 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 987 
caacggaaga agggucuuu 19 
 
 
<210> 988 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 988 
aguucucaau cacugcucc 19 
 
 
<210> 989 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 989 
ggagcaguga uugagaacu 19 
 
 
<210> 990 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 990 
ucggauuaaa cuacaucaa 19 
 
 
<210> 991 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 991 
uugauguagu uuaauccga 19 
 
 
<210> 992 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 992 
uacagagacg ucagucccu 19 
 
 
<210> 993 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 993 
agggacugac gucucugua 19 
 
 
<210> 994 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 994 
cgcgacgcgg ccuagagcg 19 
 
 
<210> 995 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 995 
cgcucuaggc cgcgucgcg 19 
 
 
<210> 996 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 996 
aagguucguu aaaaugcgc 19 
 
 
<210> 997 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 997 
gcgcauuuua acgaaccuu 19 
 
 
<210> 998 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 998 
acgguccuuu aggcagccu 19 
 
 
<210> 999 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 999 
aggcugccua aaggaccgu 19 
 
 
<210> 1000 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1000 
uaggugccag gcuguaagc 19 
 
 
<210> 1001 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1001 
gcuuacagcc uggcaccua 19 
 
 
<210> 1002 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1002 
auuauacagu gcgacagcu 19 
 
 
<210> 1003 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1003 
agcugucgca cuguauaau 19 
 
 
<210> 1004 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1004 
aucuaguucu caaucacug 19 
 
 
<210> 1005 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1005 
cagugauuga gaacuagau 19 
 
 
<210> 1006 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1006 
cuuaaaugcc gcacccuac 19 
 
 
<210> 1007 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1007 
guagggugcg gcauuuaag 19 
 
 
<210> 1008 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1008 
agguucguua aaaugcgca 19 
 
 
<210> 1009 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1009 
ugcgcauuuu aacgaaccu 19 
 
 
<210> 1010 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1010 
caacacauag ccugacccu 19 
 
 
<210> 1011 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1011 
agggucaggc uauguguug 19 
 
 
<210> 1012 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1012 
ggcagccugc cgccgucuc 19 
 
 
<210> 1013 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1013 
gagacggcgg caggcugcc 19 
 
 
<210> 1014 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1014 
gaaacucgag agaucuuac 19 
 
 
<210> 1015 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1015 
guaagaucuc ucgaguuuc 19 
 
 
<210> 1016 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1016 
cuguagcucc cgagcuacu 19 
 
 
<210> 1017 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1017 
aguagcucgg gagcuacag 19 
 
 
<210> 1018 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1018 
caugccgcgg uagguaagg 19 
 
 
<210> 1019 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1019 
ccuuaccuac cgcggcaug 19 
 
 
<210> 1020 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1020 
gggcccuuug ccuaacaca 19 
 
 
<210> 1021 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1021 
uguguuaggc aaagggccc 19 
 
 
<210> 1022 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1022 
uucacaccuc acgcucugg 19 
 
 
<210> 1023 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1023 
ccagagcgug aggugugaa 19 
 
 
<210> 1024 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1024 
uagcucccga gcuacucuc 19 
 
 
<210> 1025 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1025 
gagaguagcu cgggagcua 19 
 
 
<210> 1026 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1026 
augccgcggu agguaaggg 19 
 
 
<210> 1027 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1027 
cccuuaccua ccgcggcau 19 
 
 
<210> 1028 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1028 
cauagucgga uuaaacuac 19 
 
 
<210> 1029 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1029 
guaguuuaau ccgacuaug 19 
 
 
<210> 1030 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1030 
ugccgcggua gguaagggc 19 
 
 
<210> 1031 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1031 
gcccuuaccu accgcggca 19 
 
 
<210> 1032 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1032 
gcgacgcggc cuagagcgg 19 
 
 
<210> 1033 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1033 
ccgcucuagg ccgcgucgc 19 
 
 
<210> 1034 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1034 
ggugcucacg acucuuccu 19 
 
 
<210> 1035 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1035 
aggaagaguc gugagcacc 19 
 
 
<210> 1036 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1036 
acuagcaggc augccgcgg 19 
 
 
<210> 1037 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1037 
ccgcggcaug ccugcuagu 19 
 
 
<210> 1038 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1038 
aaauagguac agagacguc 19 
 
 
<210> 1039 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1039 
gacgucucug uaccuauuu 19 
 
 
<210> 1040 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1040 
gaaacagccu gggugacgg 19 
 
 
<210> 1041 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1041 
ccgucaccca ggcuguuuc 19 
 
 
<210> 1042 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1042 
agcaggcaug ccgcgguag 19 
 
 
<210> 1043 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1043 
cuaccgcggc augccugcu 19 
 
 
<210> 1044 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1044 
gccauuuacc aggauaucc 19 
 
 
<210> 1045 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1045 
ggauauccug guaaauggc 19 
 
 
<210> 1046 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1046 
gcgcgacgcg gccuagagc 19 
 
 
<210> 1047 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1047 
gcucuaggcc gcgucgcgc 19 
 
 
<210> 1048 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1048 
ugccuaacac augcgguca 19 
 
 
<210> 1049 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1049 
ugaccgcaug uguuaggca 19 
 
 
<210> 1050 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1050 
cggccaccca aacgaaucc 19 
 
 
<210> 1051 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1051 
ggauucguuu ggguggccg 19 
 
 
<210> 1052 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1052 
gagacgucag ucccuuuga 19 
 
 
<210> 1053 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1053 
ucaaagggac ugacgucuc 19 
 
 
<210> 1054 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1054 
ggcaugccgc gguagguaa 19 
 
 
<210> 1055 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1055 
uuaccuaccg cggcaugcc 19 
 
 
<210> 1056 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1056 
agcgcgacgc ggccuagag 19 
 
 
<210> 1057 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1057 
cucuaggccg cgucgcgcu 19 
 
 
<210> 1058 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1058 
agacauucca aggguaugg 19 
 
 
<210> 1059 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1059 
ccauacccuu ggaaugucu 19 
 
 
<210> 1060 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1060 
ccacuauacc acauggccu 19 
 
 
<210> 1061 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1061 
aggccaugug guauagugg 19 
 
 
<210> 1062 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1062 
ccgccggacc gcguagaga 19 
 
 
<210> 1063 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1063 
ucucuacgcg guccggcgg 19 
 
 
<210> 1064 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1064 
uuugccuuuc ucgugguag 19 
 
 
<210> 1065 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1065 
cuaccacgag aaaggcaaa 19 
 
 
<210> 1066 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1066 
gaguucuucc caaaucacc 19 
 
 
<210> 1067 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1067 
ggugauuugg gaagaacuc 19 
 
 
<210> 1068 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1068 
agugacuucc cauguagag 19 
 
 
<210> 1069 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1069 
cucuacaugg gaagucacu 19 
 
 
<210> 1070 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1070 
gccacccaaa cgaauccug 19 
 
 
<210> 1071 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1071 
caggauucgu uuggguggc 19 
 
 
<210> 1072 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1072 
agcccacgcc cgacuagca 19 
 
 
<210> 1073 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1073 
ugcuagucgg gcgugggcu 19 
 
 
<210> 1074 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1074 
caggcaugcc gcgguaggu 19 
 
 
<210> 1075 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1075 
accuaccgcg gcaugccug 19 
 
 
<210> 1076 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1076 
ggccacccaa acgaauccu 19 
 
 
<210> 1077 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1077 
aggauucguu uggguggcc 19 
 
 
<210> 1078 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1078 
gagcccacgc ccgacuagc 19 
 
 
<210> 1079 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1079 
gcuagucggg cgugggcuc 19 
 
 
<210> 1080 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1080 
aacaaaaacc gaaauaggu 19 
 
 
<210> 1081 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1081 
accuauuucg guuuuuguu 19 
 
 
<210> 1082 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1082 
cgacuagcag gcaugccgc 19 
 
 
<210> 1083 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1083 
gcggcaugcc ugcuagucg 19 
 
 
<210> 1084 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1084 
uagguaaggg ccgccggac 19 
 
 
<210> 1085 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1085 
guccggcggc ccuuaccua 19 
 
 
<210> 1086 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1086 
cgcagagccc acgcccgac 19 
 
 
<210> 1087 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1087 
gucgggcgug ggcucugcg 19 
 
 
<210> 1088 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1088 
guaagggccg ccggaccgc 19 
 
 
<210> 1089 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1089 
gcgguccggc ggcccuuac 19 
 
 
<210> 1090 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1090 
agagcccacg cccgacuag 19 
 
 
<210> 1091 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1091 
cuagucgggc gugggcucu 19 
 
 
<210> 1092 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1092 
guggcuacgg uccucacgg 19 
 
 
<210> 1093 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1093 
ccgugaggac cguagccac 19 
 
 
<210> 1094 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1094 
auaaauccuc agguaguac 19 
 
 
<210> 1095 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1095 
guacuaccug aggauuuau 19 
 
 
<210> 1096 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1096 
aggcaugccg cgguaggua 19 
 
 
<210> 1097 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1097 
uaccuaccgc ggcaugccu 19 
 
 
<210> 1098 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1098 
gacuagcagg caugccgcg 19 
 
 
<210> 1099 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1099 
cgcggcaugc cugcuaguc 19 
 
 
<210> 1100 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: sense strand of dsRNA 
  
<400> 1100 
gaaauaggua cagagacgu 19 
 
 
<210> 1101 
<211> 19 
<212> RNA 
<213> Artificial sequence 
  
<220>   
<223> Description of the Artificial sequence: antisense strand of dsRNA 
  
<400> 1101 
acgucucugu accuauuuc 19 
