(WO/2008/119170) METHOD OF DETERMINING RISK OF SCOLIOSIS
- Biblio. Data
- Description
- Claims
- National Phase
- Notices
- Documents
- Note: OCR Text
- Note: Text based on automatic Optical
Character Recognition processes. Please
use the PDF version for legal matters
- Note: Text based on automatic Optical
METHOD OF DETERMINING RISK OF SCOLIOSIS
TITLE OF THE INVENTION
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority, under 35 U. S. C. § 119(e), of U.S. provisional application serial No. 60/909,408, filed on March 30, 2007 and on U.S. provisional application serial No. 61/025,571 , filed on February 1, 2008. All documents above are incorporated herein in their entirety by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] N/A.
FIELD OF THE INVENTION
[0003] The present invention relates to methods of determining the risk of developing scoliosis, methods of stratifying a subject having a scoliosis, methods for assessing the efficacy of a brace on a subject having a scoliosis, and kits therefor.
BACKGROUND OF THE INVENTION
[0004] Spinal deformities and scoliosis in particular, represent the most prevalent type of orthopedic deformities in children and adolescents, while adolescent idiopathic scoliosis (AIS) represents the most common form of scoliosis.
[0005] The etiology of adolescent idiopathic scoliosis (AIS) remains poorly understood resulting in the traditional paradigm that AIS is a multi-factorial disease with a genetic predisposition.(1'7)The occurrence of a melatonin signaling dysfunction in cells derived from biopsies obtained intraoperatively from affected AIS patients has been reported.8
[0006] Unfortunately, there is no proven method or test available to identify children or adolescents at risk of developing AIS or to identify, which of the affected individuals may require treatment due to the risk of progression. Consequently, the application of current
treatments, such as bracing or surgical correction, is delayed until a significant deformity is detected or until a significant progression is clearly demonstrated, resulting in a delayed and less optimal treatment.29
[0007] The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.
SUMMARY OF THE INVENTION
[0008] More specifically, in accordance with the present invention, there is provided a method for determining the risk for developing a scoliosis comprising monitoring osteopontin (OPN) expression in a sample from a subject over time; wherein an OPN expression that increases in the subject sample over time is indicative that the subject is at risk for developing a scoliosis.
[0009] In a specific embodiment, the monitoring begins when the subject is about three years old. In another specific embodiment, the monitoring is performed by measuring OPN expression at a frequency of at least about once per month. In another specific embodiment, the monitoring is performed by measuring OPN expression at a frequency of at least about once per six month. In another specific embodiment, the method further comprises measuring sCD44 expression in a sample from the subject. In another specific embodiment, the monitoring OPN expression is performed using an enzyme- linked immunosorbent assay (ELISA) or radioimmunoassay (RIA).
[0010] In accordance with the present invention, there is provided a method for determining the risk for developing a scoliosis comprising measuring osteopontin (OPN) expression in a sample from a subject; wherein an OPN expression that is higher in the subject sample than that in a control sample is indicative that the subject is at risk for developing a scoliosis.
[0011] In another specific embodiment, the subject is a likely candidate for developing a scoliosis. In another specific embodiment, the subject is a likely candidate for developing adolescent idiopathic scoliosis. In another specific embodiment, the subject is pre- diagnosed as having a scoliosis.
[0012] In another specific embodiment, the subject is pre-diagnosed with adolescent idiopathic scoliosis.
[0013] In accordance with another aspect of the present invention, there is provided a method of stratifying a subject having a scoliosis comprising measuring osteopontin (OPN) expression in a sample from the subject; whereby the measuring step enables the stratification of the subject into a scoliosis subgroup.
[0014] In accordance with another aspect of the present invention, there is provided a method for assessing the efficacy of a brace on a subject having a scoliosis comprising measuring osteopontin (OPN) expression in a sample from the subject prior to and at least once after bracing the subject, wherein an increase in the OPN expression after as compared to prior to bracing the subject is indicative that the brace is ineffective.
[0015] In a specific embodiment, the determining the OPN expression after the bracing is performed at least one month after the bracing. In another specific embodiment, the determining the OPN expression after bracing the subject is performed at least 2 months hours after the bracing. In another specific embodiment, the determining the OPN expression after bracing the subject is performed at least three months after the bracing. In another specific embodiment, the determining the OPN expression after bracing the subject is performed at least six months after the bracing.
[0016] In another specific embodiment, the method further comprises measuring soluble CD44 receptor (sCD44) expression in the sample from the subject.
[0017] In another specific embodiment, the sample from the subject is a biological fluid from the subject. In another specific embodiment, the biological fluid is selected from the group consisting of blood, urine, tear and saliva. In another specific embodiment, the biological fluid is plasma.
[0018] In another specific embodiment, the OPN expression is OPN protein. In another specific embodiment, the determining of the OPN expression is performed with an antibody that specifically binds to OPN. In another specific embodiment, the measuring OPN expression is performed using an enzyme-linked immunosorbent assay (ELISA). In another specific embodiment, the sample is a plasma sample and an OPN expression that is higher than 700 nanograms per milliliter of plasma is indicative that the subject is at risk for developing a scoliosis. In another specific embodiment, the sample is a plasma sample and an OPN expression that is higher than 800 nanograms per milliliter of plasma is indicative that the subject is at risk for developing a scoliosis.
[0019] In another specific embodiment, the OPN expression is OPN RNA. In another specific embodiment, the sample from the subject is a paraspinal muscle biopsy and the OPN expression is OPN RNA.
[0020] In accordance with another aspect of the present invention, there is provided a method of selecting an agent as a potential candidate for the reduction or prevention of scoliosis comprising contacting a candidate agent with a cell expressing osteopontin (OPN), and detecting the expression of OPN, wherein when the expression of OPN is lower in the presence of the candidate agent as compared to in the absence thereof, the candidate agent is selected.
[0021] In accordance with another aspect of the present invention, there is provided a method of selecting an agent as a potential candidate for the reduction or prevention of scoliosis comprising contacting a candidate agent with a cell expressing sCD44, and detecting the expression of sCD44, wherein when the expression of OPN is higher in the presence of the candidate agent as compared to in the absence thereof, the candidate agent is selected.
[0022] In another specific embodiment, the cell is a cell derived from a scoliotic patient.
[0023] In accordance with another aspect of the present invention, there is provided a method of selecting an agent as a potential candidate for the prevention or reduction of scoliosis comprising administering a candidate agent to a scoliosis model animal before scoliosis has developed in the animal, whereby the candidate is selected when the scoliosis is prevented or reduced in the model animal as compared to in a control animal who was not administered the candidate agent.
[0024] In accordance with another aspect of the present invention, there is provided a method of preventing or reducing scoliosis comprising administering to a subject having scoliosis a therapeutically effective amount of an osteopontin inhibitor (OPN) or a selenium rich diet, whereby scoliosis is thereby prevented or treated.
[0025] In accordance with another aspect of the present invention, there is provided a method of preventing or reducing scoliosis comprising administering to a subject having scoliosis a therapeutically effective amount of a CD44 inhibitor, whereby scoliosis is thereby prevented or treated.
[0026] In accordance with another aspect of the present invention, there is provided a method of preventing or reducing scoliosis comprising administering to a subject having scoliosis a therapeutically effective amount of a sCD44 stimulator, whereby scoliosis is thereby prevented or treated.
[0027] In a specific embodiment of the methods of the present invention, the subject is human. In another specific embodiment of the methods of the present invention, the subject is human female. In another specific embodiment of the methods of the present invention, the subject is human male.
[0028] In accordance with another aspect of the present invention, there is provided an osteopontin inhibitor for use in the treatment or prevention of scoliosis.
[0029] In accordance with another aspect of the present invention, there is provided a CD44 inhibitor for use in the treatment or prevention of scoliosis.
[0030] In accordance with another aspect of the present invention, there is provided a sCD44 stimulator for use in the treatment or prevention of scoliosis.
[0031] In accordance with another aspect of the present invention, there is provided a use of an osteopontin inhibitor in the manufacture of a medicament for the prevention or the treatment of scoliosis.
[0032] In accordance with another aspect of the present invention, there is provided a use of an osteopontin inhibitor for the prevention or the treatment of scoliosis.
[0033] In accordance with another aspect of the present invention, there is provided a use of a CD44 inhibitor in the manufacture of a medicament for the prevention or the treatment of scoliosis.
[0034] In accordance with another aspect of the present invention, there is provided a use of a CD44 inhibitor for the prevention or the treatment of scoliosis.
[0035] In accordance with another aspect of the present invention, there is provided a use of a sCD44 stimulator in the manufacture of a medicament for the prevention or the treatment of scoliosis.
[0036] In accordance with another aspect of the present invention, there is provided a
use of a sCD44 stimulator for the prevention or the treatment of scoliosis.
[0037] In a specific embodiment of the uses of the present invention, the scoliosis is adolescent idiopathic scoliosis.
[0038] In accordance with another aspect of the present invention, there is provided a kit for predicting the risk of developing a scoliosis comprising a ligand specific to osteopontin (OPN) and instructions to use the kit for predicting the risk of developing a scoliosis. In a specific embodiment, the kit further comprises a ligand specific to soluble CD44 (SCD44).
[0039] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] In the appended drawings:
[0041] Figure 1 presents OPN detection in pinealectomized chicken and corresponding scoliosis. Upper and lower panels illustrates the up regulation of OPN expression detected in paraspinal muscles of pinealectomized chicken developing a scoliosis (S) vs. those remaining unaffected (NS) at the mRNA and protein levels respectively.;
[0042] Figure 2 graphically presents in the left panel the dynamic variation of circulating OPN levels in scoliotic bipedal C57BI/6J mice after surgery, and in the right panel presents typical x-rays of scoliotic deformities observed in bipedal C57BI/6J mice, where females (708) are more severely affected than males (907);
[0043] Figure 3 shows a variation in plasma melatonin concentrations in different mouse strains. S = scoliotic; NS = non-scoliotic;
[0044] Figure 4 shows the effect of the pharmacological inhibition of OPN transcription on scoliotic pinealectomized chicken;
[0045] Figure 5 graphically presents the sensitivity and specificity of plasma
osteopontin in healthy control subjects, AIS patients and at risk asymptomatic subjects. In Panel A, an analysis that included 33 healthy control subjects and 32 AIS patients with severe Cobb's Angle ( ≥45°) revealed an area under the curve (AUC) of 0.94 with a standard error of 0.03 (95 percent confidence interval [Cl], 0.88 to 1.000). In Panel B, the use of a cut-off value of 700 nanograms per ml of osteopontin showed a high sensitivity (90.6%) and a very good specificity (81.8%) for the early detection of AIS and for detecting the risk of scoliosis progression. In Panel C, the use of a cut-off value of 800 nanograms/ml of osteopontin also showed a high sensitivity (84.9%) and a higher specificity (90.9%) for the early detection of AIS and for detecting the risk of scoliosis progression. In Panel D, a clear correlation between the levels of plasma osteopontin and the Cobb's angle is demonstrated using all AIS patients, yielding a p-value 0.001 and 1^=0.26;
[0046] Figure 6 presents graphs showing the distribution of age in the different groups for male and female combined (control, at risk, AIS <45 and AIS >45) (Panel A), and separated by sex female (Panel B) and male (Panel C);
[0047] Figure 7 shows profiles of change in OPN levels, sCD44 levels, and
Cobb's angle over follow up time in 4 selected AIS female patients (not under brace treatment) aged 12 (red), 14 (green and blue), and 17 (yellow) at baseline visit;
[0048] Figure 8 shows the distribution of total change in OPN (left panel) and sCD44 (left panel) levels over follow-up time in AIS patients with worsened curve deformity (total increase in Cobb's angle greater than 3°; n=14) and in those without significant change in curve (no change in Cobb's angle, decrease, or increase smaller than 3°; n=36);
[0049] Figure 9 presents graphs showing OPN progression correlated with
Cobb's angle progression in AIS patients;
[0050] Figure 10 presents graphs showing OPN regression or stabilization correlated with Cobb's angle regression or stabilization in AIS patients;
[0051] Figure 11 shows profiles of change in OPN and sCD44 levels over follow up time in 4 selected at risk subjects without scoliosis: one male aged 13 (green), and 3 female aged 5 (gold), 11 (blue), and 9 (red) at baseline visit;
[0052] Figure 12 compares OPN, sCD44 and HA levels in non AIS scoliotic patients (NAIS) (OPN (n=28), sCD44 (n=18), HA (n=24)), healthy controls (n=35) and AIS patients (n=252);
[0053] Figure 13 presents a histogram comparison of circulating levels of OPN change in function of spine biomechanics in pre-operated AIS patients (n=79) vs. post- operated AIS patients (n=28);
[0054] Figure 14 presents a histogram comparison of circulating levels of OPN and sCD44 of in pre-operated AIS female (OPN (n=10); sCD44 (n=15)) vs. post- operated AIS female (OPN (n=10); sCD44 (n=12));
[0055] Figure 15 presents charts distributing AIS patients across the predefined cut-off zones pre-operation (Panel A) and post-operation (Panel B);
[0056] Figure 16 presents charts distributing AIS patients across the predefined cut-off zones prior to being treated with bracing (Panel A) and after bracing (Panel B);
[0057] Figure 17 illustrates a hypothetic molecular concept underlying spinal deformity progression in AIS;
[0058] Figure 18 presents a graph that correlates selenium levels in AIS patients with OPN levels;
[0059] Figure 19 presents a histogram comparing selenium levels in three categories of subjects : controls, low OPN producers and high OPN producers;
[0060] Figure 20 presents the nucleotide sequences of the three human OPN isoforms (transcript variant 1 , mRNA N M_001040058 (SEQ ID NO: 1); transcript variant 2, mRNA NM_000582 (SEQ ID NO: 2); transcript variant 3, mRNA N M_001040060 (SEQ ID NO: 3) and the amino acid sequences of the three human OPN isoforms (isoform a NP_001035147 (SEQ ID NO: 4); isoform b NP_000573 (SEQ ID NO: 5); and isoform c NP_001035149 (SEQ ID NO: 6));
[0061] Figure 21 presents the nucleotide sequences (mRNA) of six isoforms of human CD44 (NM_000610 transcript variant 1 (SEQ ID NO : 7); NM_001001389 transcript variant 2 (SEQ ID NO: 8); NM_001001390 transcript variant 3 (SEQ ID NO: 9); NM_001001391 transcript variant 4 (SEQ ID NO: 10); NM_001001392 transcript variant
5 (SEQ ID NO: 11 ); X62739 lsoform identified in tumour cells (SEQ ID NO: 12)) and amino acid sequences of six isoforms of human sCD44 (NP_000601 isoform 1 precursor (SEQ ID NO : 13); NP_001001389 isoform 2 precursor (SEQ ID NO: 14); NP_001001390 isoform 3 precursor (SEQ ID NO: 15); NP_001001391 isoform 4 precursor (SEQ ID NO: 16); NP_001001392 isoform 5 precursor (SEQ ID NO: 17); and CAA44602 Isoform identified in tumour cells (SEQ ID NO: 18)); and
[0062] Figure 22 shows the structure of sCD44 (Panel A), the origin of the various CD44 isoforms (Panel B) and the cleavage site in one sCD44 isoform (SEQ ID NO: 23).
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0063] The involvement of osteopontin (OPN) (also called secreted phosphoprotein 1 , bone sialoprotein I, early T-lymphocyte activation 1), a multifunctional cytokine, was investigated in adolescent idiopathic scoliosis (AIS) and plasma OPN concentrations were determined in three populations: patients with AIS, healthy controls without any family antecedent for scoliosis and asymptomatic offspring, born from at least one scoliotic parent, who are considered as at risk ("children at risk").
[0064] A group of 252 consecutive patients with AIS were compared with 35 healthy control subjects without any family history of scoliosis and 70 asymptomatic at risk subjects. All subjects were Caucasians and demographic characteristics are shown in Table 2 below. Plasma OPN, soluble CD44 receptor (sCD44), and hyaluronan (HA) levels were measured by enzyme-linked immunosorbent assays. Pinealectomized chicken and genetically modified bipedal C57BI/6J mice devoid of either OPN or CD44 receptor, a known OPN receptor, were also studied.
[0065] Mean plasma OPN concentration in patients with AIS were significantly higher (p-value <0.001) in patients with AIS having a Cobb's angle >45° (965 ± 414 nanograms per milliliter) than that in healthy controls (570 ± 156 nanograms per milliliter) and than that in AIS patients with a Cobb's angle <45° (799 ± 284 nanograms per milliliter). Diagnostic sensitivity and specificity of OPN for AIS was 84.4 percent and 90.6 percent respectively (cut-off value > 800 nanograms per milliliter). Subgroup analysis showed that 47.9 percent of children at risk had OPN values higher than 800 nanograms per milliliter as opposed to only 8.6 percent for the controls indicating that elevated plasma OPN levels precede scoliosis formation. There were no significant differences in mean plasma sCD44 levels and HA levels between all groups. In respect
to pathophysiology of scoliosis, the bipedal C57BI/6J mouse model demonstrated that the development of scoliosis requires OPN interactions with CD44 receptors since none of the genetically modified bipedal mice developed a scoliosis. Cut-off values for OPN disclosed herein were calculated using the commercial Elisa kit specific to human OPN from IBL. They may vary when a OPN expression (mRNA or protein) is measured differently (e.g. measuring OPN expression in a different biological sample through OPN RNA or OPN protein but using a different antibody).
[0066] OPN (also called secreted phosphoprotein-1 , minopontin, or Eta-1) is a phosphorylated glycoprotein containing an arginine-glycine-aspartate (RGD) sequence present in mineralized tissues such as extracellular matrices. This multifunctional cytokine is involved in many pathological conditions.9'10 The presence of OPN transcripts and proteins in postural control centers such as the cerebellum, skeletal muscle proprioceptive sensory organs, and inner ear structures that control of equilibrium(11) is of interest, since AIS patients also exhibit defects in postural control, proprioception and equilibrium.(12;13) High plasma OPN levels have been found in different adult cancers and inflammatory conditions30"33.
[0067] OPN signaling action: The OPN signaling pathways are not well understood, although it is known that aside from interacting with integrins, OPN can interact with CD44 receptor at the cell surface.14'15 Although CD44 is a major receptor for hyaluronan (HA), it also acts as a receptor for OPN and has multiple RGD binding sites. All human isoforms of the CD44 family of adhesion molecules are encoded by a single gene. Alternate splicing of 12 of the 19 exons in the human CD44 gene leads to the production of multiple variant isoforms16'17 and such structural heterogeneity is responsible of the ligand repertoire of CD44, which includes fibronectin18, chondroitin sulphate19, osteopontin20, at least two heparin binding growth hormones and hyaluronan.21'22 Soluble variant isoforms of sCD44 (sCD44var) have been associated with several pathological conditions.16'18'2324 It has been proposed that sCD44 isoforms are either generated through proteolytic cleavage of cell surface CD44 or by de novo synthesis due to alternative splicing. Functional diversity among CD44 molecules, unrelated to variant exon usage, is demonstrated by observations that CD44H, or any particular splice-variant, can be active for hyaluronan (HA) binding when expressed in some cell types but inactive in others. Many CD44 isoforms are tissue specific, but the full range of soluble variant isoform(s) of sCD44 has been
associated with some pathological conditions. Indeed, circulating levels of total sCD44 and specific soluble CD44 isoforms have been shown to correlate with tumor metastasis in some malignancies, including non-Hodgkin's lymphoma and breast, gastric, and colon carcinomas. The level of soluble CD44 is also known to be higher in the body fluids of subjects with particular inflammatory conditions, such as rheumatoid arthritis, pouchitis and colitis, and bronchitis. Hyaluronan (HA), also called hyaluronate or hyaluronic acid, is a mucopolysaccharide widely distributed throughout the body and produced by a variety of cells including fibroblasts and other specialized connective tissue cells.
[0068] As used herein the term "subject" is meant to refer to any mammal including human, mice, rat, dog, cat, pig, monkey, horse, etc. In a particular embodiment, it refers to a human.
[0069] As used herein the term "brace" is meant to include dental and orthopedic brace and "bracing" thus refers to the action of placing the braces on the subject. In a specific embodiment, it is meant to refer to braces for scoliotic subjects.
[0070] As used herein the terminology "spinal disorders and disorders causing scoliosis" refers to disorders that may involve development of a scoliosis. Without so limited, it includes AIS, congenital scoliosis, congenital cyphose scoliosis, neurological scoliosis, dysplasic scoliosis, neurofibromatosis, cerebral palsy, muscular dystrophies, neuromuscular scoliosis, spondylolesthesis and Noonan syndrome. Scoliosis that may be stratified or predicted excludes those caused by an accident and certain congenital malformations.
[0071] As used herein the terms "likely candidate for developing adolescent idiopathic scoliosis" include children of which a least one parent has adolescent idiopathic scoliosis. Among other factors, age (adolescence), gender and heredity (i.e. born from a mother or father having a scoliosis) are factors that are known to contribute to the risk of developing a scoliosis and are used to a certain degree to assess the risk of developing AIS. In certain subjects, scoliosis develops rapidly over a short period of time to the point of requiring a corrective surgery. Current courses of action available
from the moment AIS is diagnosed (when scoliosis is apparent) include observation (when Cobb's angle is around 10-25°), orthopaedic devices (when Cobb's angle is around 25-30°), and surgery (over 45°). The more reliable methods of determining the risk of progression and of monitoring treatment efficiency in accordance of the present invention may assist in 1 ) selecting an appropriate diet to remove certain food products identified as contributors to scoliosis; 2) selecting the best therapeutic agent; 3) selecting the least invasive preventive action and/or available treatment such as postural exercises, orthopaedic device, and/or less invasive surgeries or surgeries without fusions (a surgery that does not fuse vertebra and preserves column mobility).
[0072] As used herein, the terms "severe AIS" refers to a scoliosis characterized by Cobb's angle of 45° or more.
[0073] As used herein the terms "risk of developing scoliosis" refer to a genetic or metabolic predisposition of a subject to develop a scoliosis (i.e. spinal deformity) and/or to develop a more severe scoliosis at a future time. For instance, an increase of the Cobb's angle of a subject (e.g. from 40° to 50°, or from 18° to 25°) is a "development" of scoliosis.
[0074] As used herein the terminology "biological sample" refers to any solid or liquid sample isolated from a living being. In a particular embodiment, it refers to any solid or liquid sample isolated from a human. Without being so limited it includes a biopsy material, blood, tears (48), saliva, maternal milk, synovial fluid, urine, ear fluid, amniotic fluid and cerebrospinal fluid. In a specific embodiment it refers to a blood sample.
[0075] As used herein the terminology "blood sample" is meant to refer to blood, plasma or serum. In a preferred embodiment, plasma is used. In a more specific embodiment it refers to a plasma sample.
[0076] As used herein the terminology "control sample" is meant to refer to a sample that does not come from a subject known to have scoliosis or known to be a likely candidate for developing a scoliosis. In methods for determining the risk of
developing scoliosis in a subject that is pre-diagnosed with scoliosis, the sample may however also come from the subject under scrutiny at an earlier stage of the disease or disorder.
[0077] As used herein the term "treating" or "treatment" in reference to scoliosis is meant to refer to at least one of a reduction of Cobb's angle in a preexisting spinal deformity, improvement of column mobility, preservation/maintenance of column mobility, improvement of equilibrium and balance in a specific plan; maintenance/preservation of equilibrium and balance in a specific plan; improvement of functionality in a specific plan, preservation/maintenance of functionality in a specific plan, cosmetic improvement, and combination of any of the above.
[0078] As used herein the term "preventing" or "prevention" in reference to scoliosis is meant to refer to a at least one of a reduction in the progression of a Cobb's angle in a patient having a scoliosis or in an asymptomatic patient, a complete prevention of apparition of a spinal deformity, including changes affecting the rib cage and pelvis in 3D, and a combination of any of the above.
[0079] As used herein the term "osteopontin inhibitor" refers to an agent able to reduce or block expression (transcription or translation) of OPN (gene called sspM), an agent able to reduce or block OPN secretion or an agent able to reduce or block OPN binding to its receptor CD44. Without being so limited, the agent can be natural or synthetic and can be a protein such as but not limited to an antibody that specifically binds to OPN, a peptide, a small molecule, a nucleotide such as but not limited to an antisense or a si RNA specific to OPN.
[0080] As used herein the term "CD44 inhibitor" refers to an agent able to reduce expression (transcription or translation) of CD44, or an agent able to reduce CD44 localization at the cellular membrane. Without being so limited, the agent can be natural or synthetic and can be a protein such as but not limited to an antibody that specifically binds to CD44, a peptide, a small molecule, a nucleotide such as but not limited to an antisense or a siRNA specific to CD44.
[0081] As used herein the term "sCD44 stimulator" refers to an agent able to increase expression (transcription or translation) of sCD44, an agent able to increase sCD44 secretion or an agent able to increase sCD44 affinity toward OPN. Without being so limited, the agent can be a protein, a peptide, a small molecule or a nucleotide.
[0082] The articles "a," "an" and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
[0083] The term "including" and "comprising" are used herein to mean, and re used interchangeably with, the phrases "including but not limited to" and "comprising but not limited to".
[0084] The terms "such as" are used herein to mean, and is used interchangeably with, the phrase "such as but not limited to".
[0085] The present invention also relates to methods for the determination of the level of expression (i.e. transcript or translation product) of OPN, HA or sCD44. The present invention therefore encompasses any known method for such determination including Elisa (Enzyme Linked Immunosorbent Assay), RIA (Radioimmunoassay), real time PCR and competitive PCR, Northern blots, nuclease protection, plaque hybridization and slot blots.
[0086] The present invention also concerns isolated nucleic acid molecules including probes and primers to detect OPN, sCD44 or CD44. In specific embodiments, the isolated nucleic acid molecules have no more than 300, or no more than 200, or no more than 100, or no more than 90, or no more than 80, or no more than 70, or no more than 60, or no more than 50, or no more than 40 or no more than 30 nucleotides. In specific embodiments, the isolated nucleic acid molecules have at least 17, or at least 18, or at least 19, or at least 20, or at least 30, or at least 40 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 300 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 200 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 100 nucleotides. In
other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 90 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 80 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 70 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 60 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 50 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 40 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 17 and no more than 40 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 20 and no more than 30 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 17 and no more than 30 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 300 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 200 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 100 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 90 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 80 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 70 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 60 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 50 nucleotides. In other specific embodiments, the isolated nucleic acid molecules have at least 30 and no more than 40 nucleotides. It should be understood that in real-time PCR, primers also constitute probe without the traditional meaning of this term. Primers or probes appropriate to detect OPN sCD44 and CD44 in the methods of the present invention can be designed with known methods using sequences distributed across their respective nucleotide sequence (49).
[0087] Probes of the invention can be utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and α-nucleotides and the like. Modified sugar-phosphate backbones are generally known. Probes of the invention can
be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
[0088] The types of detection methods in which probes can be used include
Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Although less preferred, labeled proteins could also be used to detect a particular nucleic acid sequence to which it binds. Other detection methods include kits containing probes on a dipstick setup and the like.
[0089] As used herein the terms "detectably labeled" refer to a marking of a probe or an antibody in accordance with the presence invention that will allow the detection of OPN, HA and/or sCD44 in accordance with the present invention. Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial, by increasing the sensitivity of the detection. Furthermore, it enables automation. Probes can be labeled according to numerous well known methods. Non-limiting examples of labels include 3H, 14C, 32P, and 35S. Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.
[0090] As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods. Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP (e.g. uniformly labeled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.
[0091] The present invention also relates to methods of selecting compounds. As used herein the term "compound" is meant to encompass natural, synthetic or semi-synthetic compounds, including without being so limited chemicals,
macromolecules, cell or tissue extracts (from plants or animals), nucleic acid molecules, peptides, antibodies and proteins.
[0092] The present invention also relates to arrays. As used herein, an
"array" is an intentionally created collection of molecules which can be prepared either synthetically or biosynthetically. The molecules in the array can be identical or different from each other. The array can assume a variety of formats, e.g., libraries of soluble molecules; libraries of compounds tethered to resin beads, silica chips, or other solid supports.
[0093] As used herein "array of nucleic acid molecules" is an intentionally created collection of nucleic acids which can be prepared either synthetically or biosynthetically in a variety of different formats (e.g., libraries of soluble molecules; and libraries of oligonucleotides tethered to resin beads, silica chips, or other solid supports). Additionally, the term "array" is meant to include those libraries of nucleic acids which can be prepared by spotting nucleic acids of essentially any length (e.g., from 1 to about 1000 nucleotide monomers in length) onto a substrate. The term "nucleic acid" as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides, deoxyribonucleotides or peptide nucleic acids (PNAs), that comprise purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups, as may typically be found in RNA or DNA, or modified or substituted sugar or phosphate groups. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. The sequence of nucleotides may be interrupted by non-nucleotide components. Thus the terms nucleoside, nucleotide, deoxynucleoside and deoxynudeotide generally include analogs such as those described herein. These analogs are those molecules having some structural features in common with a naturally occurring nucleoside or nucleotide such that when incorporated into a nucleic acid or oligonucleotide sequence, they allow hybridization with a naturally occurring nucleic acid sequence in solution. Typically, these analogs are derived from naturally occurring nucleosides and nucleotides by replacing and/or modifying the base, the ribose or the phosphodiester moiety. The changes can be tailor made to stabilize or destabilize hybrid formation or enhance the specificity of hybridization with a complementary nucleic acid sequence as desired.
[0094] As used herein "solid support", "support", and "substrate" are used interchangeably and refer to a material or group of materials having a rigid or semi-rigid surface or surfaces. In many embodiments, at least one surface of the solid support will be substantially flat, although in some embodiments it may be desirable to physically separate synthesis regions for different compounds with, for example, wells, raised regions, pins, etched trenches, or the like. According to other embodiments, the solid support(s) will take the form of beads, resins, gels, microspheres, or other geometric configurations.
[0095] Any known nucleic acid arrays can be used in accordance with the present invention. For instance, such arrays include those based on short or longer oligonucleotide probes as well as cDNAs or polymerase chain reaction (PCR) products. Other methods include serial analysis of gene expression (SAGE), differential display, as well as subtractive hybridization methods, differential screening (DS), RNA arbitrarily primer (RAP)-PCR, restriction endonucleolytic analysis of differentially expressed sequences (READS), amplified restriction fragment-length polymorphisms (AFLP).
Antibodies
[0096] The present invention encompasses using antibodies for detecting or determining OPN, sCD44 or CD44 levels for instance in the samples of a subject and for including in kits of the present invention. Antibodies that specifically bind to these biological markers can be produced routinely with methods further described below. The present invention also encompasses using antibodies commercially available. Without being so limited antibodies that specifically bind to OPN include those listed in Table 1 below.
[0097] Table 1 commercially available human OPN Elisa kits.
[0098] Both monoclonal and polyclonal antibodies directed to OPN are included within the scope of this invention as they can be produced by well established procedures known to those of skill in the art. Additionally, any secondary antibodies, either monoclonal or polyclonal, directed to the first antibodies would also be included within the scope of this invention.
[0099] As used herein, the term "anti-OPN antibody" or "immunologically specific anti- OPN antibody" refers to an antibody that specifically binds to (interacts with) an OPN protein and displays no substantial binding to other naturally occurring proteins other than the ones sharing the same antigenic determinants as the OPN protein. The term antibody or immunoglobulin is used in the broadest sense, and covers monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, and antibody fragments so long as they exhibit the desired biological activity. Antibody fragments comprise a portion of a full length antibody,
generally an antigen binding or variable region thereof. Examples of antibody fragments include Fab, Fab1, F(ab')2, and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody fragments. Antibody fragments can also refer to binding moieties comprising CDRs or antigen binding domains including, but not limited to, VH regions (VH, VH-VH), anticalins, PepBodies™, antibody-T-cell epitope fusions (Troybodies) or Peptibodies. Additionally, any secondary antibodies, either monoclonal or polyclonal, directed to the first antibodies would also be included within the scope of this invention.
[00100] In general, techniques for preparing antibodies (including monoclonal antibodies and hybridomas) and for detecting antigens using antibodies are well known in the art (Campbell, 1984, In "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publisher, Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody A Laboratory Manual, CSH Laboratories). The term antibody encompasses herein polyclonal, monoclonal antibodies and antibody variants such as single-chain antibodies, humanized antibodies, chimeric antibodies and immunologically active fragments of antibodies (e.g. Fab and Fab1 fragments) which inhibit or neutralize their respective interaction domains in Hyphen and/or are specific thereto.
[00101] Polyclonal antibodies are preferably raised in animals by multiple subcutaneous (sc), intravenous (iv) or intraperitoneal (ip) injections of the relevant antigen with or without an adjuvant. It may be useful to conjugate the relevant antigen to a protein that is immunogenic in the species to be immunized, e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example, maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOCI2, or R1N=C=NR, where R and R1 are different alkyl groups.
[00102] Animals may be immunized against the antigen, immunogenic conjugates, or derivatives by combining the antigen or conjugate (e.g., 100 μg for rabbits or 5 μg for mice) with 3 volumes of Freund's complete adjuvant and injecting the solution
intradermally at multiple sites. One month later the animals are boosted with the antigen or conjugate (e.g., with 1/5 to 1/10 of the original amount used to immunize) in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus. Preferably, for conjugate immunizations, the animal is boosted with the conjugate of the same antigen, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are suitably used to enhance the immune response.
[00103] Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature, 256: 495 (1975), or may be made by recombinant DNA methods (e.g., U.S. Patent No. 6,204,023). Monoclonal antibodies may also be made using the techniques described in U.S. Patent Nos. 6,025,155 and 6,077,677 as well as U.S. Patent Application Publication Nos. 2002/0160970 and 2003/0083293 (see also, e.g., Lindenbaum et al., 2004).
[00104] In the hybridoma method, a mouse or other appropriate host animal, such as a rat, hamster or monkey, is immunized (e.g., as hereinabove described) to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the antigen used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell.
[00105] The hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.
[00106] As used herein, the term "purified" in the expression "purified antibody" is simply meant to distinguish man-made antibody from an antibody that may
naturally be produced by an animal against its own antigens. Hence, raw serum and hybridoma culture medium containing anti-OPN antibody are "purified antibodies" within the meaning of the present invention.
[00107] The present invention also encompasses arrays to detect and/or quantify the translation products of OPN, HA or sCD44. Such arrays include protein micro- or macroarrays, gel technologies including high-resolution 2D-gel methodologies, possibly coupled with mass spectrometry imaging system at the cellular level such as microscopy combined with a fluorescent labeling system.
[00108] The present invention also encompasses methods for identifying specific mutation(s) directly or indirectly affecting the transcription, translation, post- translational modification or activity of OPN. Without being so limited, mutations of interest include any mutation affecting the interactions between OPN and any soluble or non soluble isoform of CD44 or the binding of HA to any soluble or non soluble isoform of CD44.
[00109] The present invention also encompasses the monitoring of the biomarkers disclosed herein to assess the efficacy of numerous approaches to prevent scoliosis and curve progression such as any physical therapies (e.g. postural exercises, physiotherapies, biomechanical stimulations by manipulation or using specific devices e.g. vibrant plates); the monitoring of bracing efficacy or development of novel braces; the monitoring of new surgical devices with or without fusion of vertebras, and the monitoring of the efficacy of specific diet, nutraceutical and/or pharmacological treatments. Without being so limited, the first measure after the braces have been applied could be performed 1 month later to determine for instance whether the braces are well adjusted and determine whether the patient is compliant to the treatment. Thereafter, the monitoring could be performed every three to six months depending on whether high OPN levels are detected or not. This method of the present invention may advantageously reduces the requirement for x-rays. X-rays could be performed for instance only at visits where OPN levels detected are too high.
[00110] The present invention also encompasses the monitoring of the biomarkers disclosed herein identify patients having a risk of progression for early
bracing or for less-invasive surgeries with novel fusionless devices, for pharmacological treatments and to monitor responses to treatment in patients with AIS. Of note, fusionless devices are particularly useful for patients still possessing a growth potential so that identification of the risk of developing a scoliosis as early as possible in the life of the subject is beneficial. In a specific embodiment, monitoring begins when the subject is about 5 years old or less in subjects having a scoliosis family antecedent/history. The frequency of the testing could typically be every six months. In case where OPN values are above the cut-off value (i.e. > 800 ng/ml when the OPN IBL ELISA kit code No. 27158 is used), the frequency would be advantageously significantly increased (e.g. every month, every two months, every three months...).
[00111] The present invention also encompasses methods to screen/select for potential useful therapeutic agents using whole cells assays, the therapeutic compound being able to repress the transcription and/or synthesis of OPN (encoded by ssp1 gene), and/or able to increase the production of sCD44 which could sequester circulating OPN, and/or able to interfere with OPN liaison with the CD44 receptor, and/ or able to block CD44 receptor. Cells for use in such methods includes cells of any source (including in house or commercially available cell lines) and type (any tissue). In house cell lines could be made for instance by immortalizing cells from AIS subjects. In specific embodiments, methods of screening of the invention seek to identify agents that inhibit OPN expression (transcription and/or translation) and agents that increase sCD44 expression (transcription and/or translation). Useful cell lines for these embodiments include those producing high levels of OPN and/or low levels of sCD44. Such useful cell lines are described in references 43-56.
[00112] In a particular embodiment, it includes cells of any cell type derived from a scoliotic patient, (whole cell assay). In specific embodiments, it includes osteoblasts, chondrocytes, myoblasts or blood cells including lymphocytes. As used herein, the term "cell derived from a scoliotic patient" refers to cells isolated directly from scoliotic patients, or immortalized cell lines originating from cells isolated directly from scoliotic patients. In specific embodiments, the cells are paraspinal muscle cells. Such cells may be isolated by a subject through needle biopsies for instance.
[00113] Pharmaceutical compositions can also be administered by routes
such as nasally, intravenously, intramuscularly, subcutaneously, sublingually, intrathecal^, or intrademnally. The route of administration can depend on a variety of factors, such as the environment and therapeutic goals.
Dosage
[00114] Any amount of a pharmaceutical and/or nutraceutical and/or dietary supplement compositions can be administered to a subject. The dosages will depend on many factors including the mode of administration. Typically, the amount of anti-scoliosis composition (e.g. osteopontin inhibitor or selenium compound) contained within a single dose will be an amount that effectively prevents, delays or reduces scoliosis without inducing significant toxicity "therapeutically effective amount".
[00115] In some embodiments, the therapeutically effective amount of the neutraceutical anti-scoliosis composition (e.g. selenium supplement) can be altered. Useful effective amount concentrations include amounts ranging from about 0.01% to about 10% of a total diet on a weight by weight basis, from about 1% to about 6% of a total diet on a weight by weight basis, or from about 02% to about 6% of a total diet on a weight by weight basis.
[00116] The effective amount of the osteopontin inhibitor or selenium compound may also be measured directly. The effective amount may be given daily or weekly or fractions thereof. Typically, a pharmaceutical and/or nutraceutical and/or dietary supplement composition of the invention can be administered in an amount from about 0.001 mg up to about 500 mg per kg of body weight per day (e.g., 10 mg, 50 mg, 100 mg, or 250 mg). Dosages may be provided in either a single or multiple dosage regimen. For example, in some embodiments the effective amount is a dose that ranges from about 1 mg to about 25 grams of the anti-scoliose preparation per day, about 50 mg to about 10 grams of the anti-scoliose preparation per day, from about 100 mg to about 5 grams of the anti-scoliose preparation per day, about 1 gram of the anti-scoliose preparation per day, about 1 mg to about 25 grams of the anti-scoliose preparation per week, about 50 mg to about 10 grams of the anti-scoliose preparation per week, about 100 mg to about 5 grams of the anti-scoliose preparation every other day, and about 1 gram of the anti-scoliose preparation once a week.
[00117] By way of example, a pharmaceutical (e.g. containing an osteopontin inhibitor) and/or nutraceutical (e.g. containing selenium) and/or dietary supplement (e.g. containing selenium) composition of the invention can be in the form of a liquid, solution, suspension, pill, capsule, tablet, gelcap, powder, gel, ointment, cream, nebulae, mist, atomized vapor, aerosol, or phytosome. For oral administration, tablets or capsules can be prepared by conventional means with at least one pharmaceutically acceptable excipient such as binding agents, fillers, lubricants, disintegrants, or wetting agents. The tablets can be coated by methods known in the art. Liquid preparations for oral administration can take the form of, for example, solutions, syrups, or suspension, or they can be presented as a dry product for constitution with saline or other suitable liquid vehicle before use. Dietary supplements of the invention also can contain pharmaceutically acceptable additives such as suspending agents, emulsifying agents, non-aqueous vehicles, preservatives, buffer salts, flavoring, coloring, and sweetening agents as appropriate. Preparations for oral administration also can be suitably formulated to give controlled release of the active ingredients.
[00118] In addition, a pharmaceutical (e.g. containing an osteopontin inhibitor) and/or nutraceutical (e.g. containing selenium) and/or dietary supplement (e.g. containing selenium) composition of the invention can contain a pharmaceutically acceptable carrier for administration to a mammal, including, without limitation, sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of nonaqueous solvents include, without limitation, propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters. Aqueous carriers include, without limitation, water, alcohol, saline, and buffered solutions. Pharmaceutically acceptable carriers also can include physiologically acceptable aqueous vehicles (e.g., physiological saline) or other known carriers appropriate to specific routes of administration.
[00119] An osteopontin inhibitor or selenium may be incorporated into dosage forms in conjunction with any of the vehicles which are commonly employed in pharmaceutical preparations, e.g. talc, gum arabic, lactose, starch, magnesium searate, cocoa butter, aqueous or non-aqueous solvents, oils, paraffin derivatives or glycols. Emulsions such as those described in U.S. Pat. No. 5,434,183, may also be used in which vegetable oil (e.g., soybean oil or safflower oil), emulsifying agent (e.g., egg yolk phospholipid) and water are combined with glycerol. Methods for preparing appropriate
formulations are well known in the art (see e.g., Remington's Pharmaceutical Sciences, 16th Ed., 1980, A. Oslo Ed., Easton, Pa.).
[00120] In cases where parenteral administration is elected as the route of administration, preparations containing osteopontin inhibitor or selenium may be provided to patients in combination with pharmaceutically acceptable sterile aqueous or non-aqueous solvents, suspensions or emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil, fish oil, and injectable organic esters. Aqueous carriers include water, water-alcohol solutions, emulsions or suspensions, including saline and buffered medical parenteral vehicles including sodium chloride solution, Ringer's dextrose solution, dextrose plus sodium chloride solution, Ringer's solution containing lactose, or fixed oils. Intravenous vehicles may include fluid and nutrient replenishers, electrolyte replenishers, such as those based upon Ringer's dextrose, and the like.
[00121] These are simply guidelines since the actual dose must be carefully selected and titrated by the attending physician based upon clinical factors unique to each patient or by a nutritionist. The optimal daily dose will be determined by methods known in the art and will be influenced by factors such as the age of the patient and other clinically relevant factors. In addition, patients may be taking medications for other diseases or conditions. The other medications may be continued during the time that the osteopontin inhibitor or selenium compound is given to the patient, but it is particularly advisable in such cases to begin with low doses to determine if adverse side effects are experienced.
[00122] The present invention also relates to kits. Without being so limited, it relates to kits for stratifying scoliotic subjects and/or predicting whether a subject is at risk of developing a scoliosis comprising an isolated nucleic acid, a protein or a ligand such as an antibody in accordance with the present invention as described above. For example, a compartmentalized kit in accordance with the present invention includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or
solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include a container which will accept the subject sample (DNA genomic nucleic acid, cell sample or blood samples), a container which contains in some kits of the present invention, the probes used in the methods of the present invention, containers which contain enzymes, containers which contain wash reagents, and containers which contain the reagents used to detect the extension products. Kits of the present invention may also contain instructions to use these probes and or antibodies to stratify scoliotic subjects or predict whether a subject is at risk of developing a scoliosis.
[00123] The present invention is illustrated in further details by the following non- limiting examples.
EXAMPLE 1 Material and methods
[00124] GENERATION OF BIPEDAL C57BL/6J OPN-NULL AND CD44-NULL MICE. Experiments in mice were conducted according to protocols approved by The Ste- Justine Hospital's Animal Health Care Review Committee. Breeding pairs of C57BI/6 devoid of either OPN (OPN-null mice) or CD44 receptor (CD44-null mice) backcrossed for more than 10 generations in C57BI/6J mice were graciously obtained from Dr. Susan Rittling, (Rutger University, NJ, USA) and Dr. Tak Mak (University of Toronto, ON, Canada), respectively, to establish new colonies, while C57BI/6J mice served as wild- type control mice (Charles-River, Wilmington, MA, USA). The C57BI6/6J mouse strain was used because it is naturally deficient in melatonin(26), exhibits high circulating OPN levels(27) and develops scoliosis when they are maintained in a bipedal state. (28) It is a well known scoliosis animal model. Bipedal surgeries were performed after weaning by amputation of the forelimbs and tail under anesthesia as reported previously.(28) All mice underwent complete radiographic examination under anesthesia using a Faxitron™ X- rays apparatus (Faxitron X-rays Corp. Wheeling, IL, USA) every two weeks starting at the age of six weeks. Anteroposterior X-rays were taken and each digital image was evaluated subsequently for the presence of scoliosis. Cobb's angle threshold value of 10° or higher was retained as a significant scoliotic condition.
[00125] IMMUNODETECTION OF MOUSE OPN Mouse serum was obtained from
peripheral blood samples for the determination of serum levels of OPN and were collected in serum separator tubes containing silica gel (BD Microtainer, BD New Jersey, USA) and then centrifuged. Derived serum samples were aliquoted and kept frozen at - 800C until thawed and analyzed. Serum concentrations of OPN were measured by capture enzyme-linked immunosorbent assays (ELISA) according to the protocol provided by the manufacturer (IBL, Hamburg, Germany). The OPN ELISA kit measured total concentration of both phosphorylated and non-phosphorylated of all isoforms of OPN in serum. ELISA tests were performed in duplicate and the optical density was measured at 450 nm using an AsysHiTech™ Expert-96 microplate reader (Biochrom, Cambridge, UK). Although serum was used in mice herein, the present invention also encompasses measuring OPN in mice plasma.
[00126] GENERATION OF PINEALECTOMIZED CHICKENS. A percentage of pinealectomized chickens develop a scoliosis and they are thus used as a scoliosis model. For this study, 145 newly hatched chickens (Mountain Hubbard) were purchased at a local hatchery and pinealectomy were performed as previously described(25).
[00127] EXPRESSION ANALYSIS AND IMMUNODETECTION OF CHICKEN OPN. Total cellular RNA was prepared from paraspinal muscles of pinealectomized chickens by phenol/chloroform extraction. For RT-PCR, 1 microgramme total RNA was reversed transcribed using ThermoScript™ reverse transcriptase (Invitrogen), and the equivalent of 0.1 microgramme of reverse-transcribed RNA used for PCR reactions. These were carried out in a final volume of 50 microliters containing 200 micromolars dNTPs, 1.5 millimolars MgCI2, 10 picomolars each primer, and 1U Pfu DNA-polymerase (Stratagene, LaJoIIa, CA, USA). PCR reactions were performed using the following primers and conditions: chicken OPN (420 bp PCR product): 5'- ACACTTTCACTCCAATCGTCC -31 (SEQ ID NO: 19)(forward), 5'- TGCCCTTTCCGTTGTTGTCC-3' (SEQ ID NO: 20) (reverse) 35 cycles: 95°C/45 seconds, 66°C/45 seconds, 72°C/1 minute. For quantitative analysis, all amplifications were normalized against that of the housekeeping gene β-actin; chicken β-actin (460 bp PCR product) 5'-GGAAATCGTGCGTGACAT-3■ (SEQ ID NO: 21) (forward), 5'- TCATGATGGAGTTGAATGTAGTT-S1 (SEQ ID NO: 22) (reverse) 32 cycles: 940C/ 45 seconds, 55°C/45 seconds, 72°C/1 minute. PCR amplified products were analyzed on 1.5% agarose gel containing ethidium bromide. Total protein extracts of paraspinal muscles were used to detect chicken OPN by Western blot using anti-human OPN
antibodies cross-reacting with chicken OPN (clone 8E5, Kamiya Biomedial , WA, USA).
[00128] HUMAN POPULATIONS The institutional review boards of The Sainte-Justine Hospital, The Montreal Children's Hospital, The Shriners Hospital for Children in Montreal, McGiII University and The Affluent School Board, approved the study. Parents or legal guardians of all participants gave written informed consent, and minors gave their assent.
[00129] All patients with AIS were examined by one of six orthopedic surgeons. A person was deemed to be affected if history and physical examination were consistent with the diagnosis of idiopathic scoliosis and a minimum of a ten degree curvature in the coronal plane with vertebral rotation was found on a standing radiograph of the spine. Healthy controls were recruited in elementary schools of Montreal. Each subject was examined by the same orthopedic surgeon using Adam's forward bending-test with a scoliometer.
[00130] Three populations were investigated: patients with AIS, healthy controls without any family antecedent/history for scoliosis and asymptomatic offspring, born from at least one scoliotic parent, who are considered as at risk of developing a scoliosis. A group of 252 consecutive patients with AIS, 35 healthy control subjects and 70 asymptomatic children at risk of developing a scoliosis were recruited. All subjects were Caucasians and demographic characteristics are shown in Table 2 below).
Table 2. Demographic and clinical characteristics of patients with AIS1 healthy control and at risk control subjects.
Characteristics Subject Type
AIS Healthy Control Subjects At Risk Control Subjects
Female Male Female Male Female Male
Number 215 37 19 16 45 25
Mean Age (Years) 14.1 ± 2.1 14.8 ± 2.2 10.6 ±0.6 10.9 ±0.6 9.8 ± 3.7 10.0 ± 2.9
Patient percentage & Mean Cobb's Angle
Thoracolumbar 35.8% 22.5 ± 15.2 29.7% 28.3 ± 22.8
Thoracic 20.5% 39.7 ± 20.4 29.7% 34.1 ± 22.3
Double Scoliosis 30.2% 24.3% (Thoracic + Lumbar)
Thoracic Curvature 34.8 ± 19.0 38.9 ± 21.2 Lumbar Curvature 31.0 ± 17.3 33.0 ± 18.7 O Lumbar 4.7% 25.4 ± 10.7 8.1% 20.3 ± 3.5
Double Scoliosis
6.0% (Thoracic + Thoracolumbar) 5.4%
Thoracic Curvature 25.4 ± 13.5 36.0 ± 19.8 Lumbar Curvature 25.2 ± 15.5 41.0 ± 29.7 Triple Scoliosis 1.9% 36.8 ± 18.5 2.7% 8.0
41.0 ± 14.3 11.0
30.5 ± 7.7 11.0
Double Scoliosis
0.9% (Thoracic+Thoracic)
29.0 ± 5.7
16.5 ± 3.5
Heredity 36.3 % 378% 0.0% 0.0% 100.0% 100.0%
* Plus-minus values are means ± standard deviations f Mean Cobb's Angles for double scoliosis are represented by the curvatures on the thoracic and lumbar levels separately t Mean Cobb's Angle for the tπple scoliosis represents two thoracic curvatures and one lumbar curvature.
[00131] OSTEOPONTIN, SCD44 AND HA ENZYME-LINKED IMMUNOSORBENT ASSAYS
Peripheral blood samples for AIS patients, asymptomatic children and control groups were collected in EDTA-containing tubes and then centrifuged. Derived plasma samples were aliquoted and kept frozen at -8O0C until thawed and analyzed. Plasma concentrations of OPN and sCD44 were measured by capture enzyme-linked immunosorbent assays (ELISA) according to protocols provided by the manufacturer (IBL, Hamburg, Germany). The sCD44 Elisa kit (sCD44std) measured all circulating (soluble) CD44 isoforms comprising the standard protein sequences but not the rare isoforms associated with alternative splicing between exons V2 and V10 (50) (see also Figure 22). The OPN IBL ELISA kit (code No. 27158) measures total concentration of both phosphorylated and non-phosphorylated of all isoforms of OPN in plasma. Circulating levels of HA were measured in all plasma samples using an ELISA kit (HA- Elisa (K-1200), Echelon Biosciences, Salt Lake City, UT). All ELISA tests were performed in duplicate and the optical density was measured at 450 nm (for OPN and sCD44) and 405 nm (for HA) using an AsysHiTech Expert-96™ microplate reader (Biochrom, Cambridge, UK). Other Elisa kits available commercially or house made can be used in methods of the present invention. The cut-off value that statistically distinguishes non scoliotic subjects from scoliotic subjects that will help predict the risk of scoliosis progression as determined with these other kits will likely differ from that calculated with the kit used herein. It may however be calculated for each new antibody used as described herein.
[00132] STATISTICAL ANALYSIS Age and gender differences among the different AIS and control groups were assessed using Pearson's Chi-square and Student's t tests, respectively. Multiple linear regression models were used to test for association between groups and levels of OPN, sCD44, and HA. Values were adjusted for age, gender, and age-gender interaction when these potential confounders were associated with the biomarker levels at p<0.1. Interactions between group and gender were also investigated. It was first tested for an overall group effect using a global F test comparing models with and without group effects. Were then tested specific differences between groups, applying a Bonferroni correction for multiple testing. Receiver-operating characteristics (ROC) curves were used to evaluate the diagnostic value of OPN, and to identify the optimal threshold values. The sensitivity (proportion of true-positive results when the assay was applied to patients known to have AIS) and specificity (proportion of true-negative results when the assay was applied to healthy controls) of OPN were
profiled by curves. The area under ROC curve (AUC) and associated 95% confidence interval were calculated. The test of the hypothesis that the theoretical AUC is 0.5 was based on the confidence interval. Statistical analysis was performed with the SAS software, version 9.1, with the exception of the ROC curve analysis, which was performed with the ROCR package for R (www.r-project.org) (51'52>. in all analyses except when otherwise mentioned a p-value < 0.05 was considered statistically significant.
EXAMPLE 2 mRNA and protein OPN levels pinealectomized chicken
[00133] Expression analysis and immunodetection analysis of OPN in pinealectomized chicken were performed as described in Example 1 above. OPN at the mRNA and protein levels occurring in pinealectomized chicken were measured. Figure 1 shows a strong increase of OPN at the mRNA and protein levels only in pinealectomized chicken that developed a scoliosis.
EXAMPLE 3
OPN protein levels in C57BI/6J mice
[00134] Bipedal C57BI/6J mice were generated and their OPN level was determined as described in Example 1 above. Bipedal ambulation for 8 weeks in C57BI/6J mice induced scoliosis at a rate of 46 percent in females and 24 percent in males which correlated well with higher plasma OPN levels found in females (Table 3 below). The relevance of this animal model is strengthened by the fact that scoliosis are more frequently seen in number and severity in bipedal C57BI/6J females (46%) when compared to bipedal males (24%) as is also observed in humans.
[00135] Table 3. Scoliosis frequency in naturally melatonin deficient mouse strain C57BI/6J mice and genetically modified C57BI mice devoid of OPN or CD44.
.. . .. . Mean period of n % Oi scoliosis . „ follow-up
21 24% 57 weeks +/ - 3
C57BI/6J
9 28 46% 57 weeks +/ - 3
β 30 0% 54 weeks +1 - 2
OPN-null
9 24 0% 54 weeks +/ - 2
29 0% 52 weeks +/ - 2
CD44-null S
9 31 0% 52 weeks +/ - 2
[00136] Figure 2 shows that the OPN protein level strongly increases after bipedal surgery (i.e. during scoliosis development) in scoliotic C57BI/6J mice.
EXAMPLE 4
Observation of effect of absence of OPN or CD44 bipedal C57BI/6J mice on scoliosis
[00137] The contribution of OPN and CD44 receptor as an integral part of the pathophysiology cascade in scoliosis formation and curve progression was also examined by studying genetically modified bipedal C57BI/6J mice by conducting experiments as described in Example 1 above. As shown in Table 3 above, it was found that none of the bipedal C57BI/6J OPN-null (n=54) and C57BI/6J CD44-null mice (n=60) respectively, developed a scoliosis even if their analysis was extended over 52 weeks. Scoliosis development is detected 8 weeks after the surgery. A longer follow-up was performed to demonstrate that scoliosis development was not simply delayed in OPN- null and CD44-null mice.
[00138] In parallel, melatonin circulating levels were measured in wild-type and
OPN-KO mice to exclude the possibility that absence of scoliosis in bipedal C57BI/6 OPN-KO mice was due to an increased production of melatonin.
[00139] Figure 3 shows a two-fold decrease in circulating melatonin level of bipedal
C57BI/6J OPN KO mice when compared to wild-type ones (C57BI/6J, C57BI/6J and FVB).
[00140] As indicated above, C57BI/6J mice are melatonin deficient and may develop a scoliosis (S) in contrast to the FVB strain, which produces high melatonin levels. OPN-knockout mice do not develop a scoliosis (NS) even if they are in the same genomic background (C57BI6/J), although melatonin is markedly decreased, suggesting that melatonin negatively regulates OPN expression and synthesis in vivo. Without being bound by this hypothesis, it is also suggested that in absence of OPN in genetically modified mice, the melatonin level will be further decreased accordingly as an adaptive physiological response to enhance OPN expression and synthesis.
EXAMPLE 5
Effect of OPN inhibitors on scoliosis prevention
[00141] Two compounds suspected of having an effect on OPN transcription or synthesis were injected intraperitonealy at a dosage of 500μg/kg of body weight/day to chicken 24-48h prior pinealectomy.
[00142] As is apparent in Figure 4, fewer pinealectomized chicken pre-treated with the drugs developed scoliosis (a reduction of 50%) than untreated pinealectomized chickens.
EXAMPLE 6
Comparing the level of circulating OPN in AIS patients classified in two groups and healthy controls
[00143] A group of 252 patients with AIS and 35 healthy control subjects were tested as described in Example 1 above. Patients with AIS were divided into two subgroups according to their spinal curve severity (10°-44° vs. ≥45°) In the most severely affected AIS subgroup, none of the patients had corrective surgery at the time of the tests. Consistent with literature reporting increased AIS prevalence in teenage girls when compared to boys for moderate curves (ratio 10:1 for curve with a Cobb's angle ≥ 30°), a greater proportion of girls in the AIS groups (86% and 84%in the 10° -44° and >45° subgroups, respectively were observed compared to the control groups (54% and 64% in healthy and at risk control groups, respectively, p ≤ 0.0001 when comparing the control groups). There was no significant gender difference between the two AIS subgroups (p=0.76) or between the two control groups (p=0.32). Mean age was significantly higher
in AIS patients with Cobb's angle ≥45° compared to those with 10-44° angle (15.2 ± 1.8 vs. 13.8 ± 2.1, p<0.0001). Both AIS groups had higher mean age compared to control groups (10.7 ± 0.6 for the healthy and 9.9 ± 3.4 for the at risk group, p<0.0001 when comparing to either AIS group).
[00144] The plasma OPN levels in patients with AIS exhibiting a severe deformity (Cobb's angle > 45°), low to moderate curve (Cobb's angle between 10° and 44°) and healthy controls are summarized in Table 4 below according to various clinical parameters. The mean plasma OPN levels were significantly higher in both AIS groups when compared to healthy control group although plasma OPN levels were more elevated in patients with the most severe deformities (Cobb's angle ≥ 45°) (Bonferroni- corrected p<0.001 after adjustment for age, gender, and age-gender interaction). Plasma OPN levels in AIS patients were correlated with the severity of curve deformity (Figure 5D) in girls and boys (Partial Pearson correlation coefficient adjusted for age = 0.29, p < 0.001 , and 0.33, p = 0.04, respectively). Mean plasma OPN levels in the group at risk of developing scoliosis (846 ± 402 ng/ml) differed significantly (Bonferroni- corrected p<0.001) from the healthy controls (570 ± 156 ng/ml).
Table 4. Mean biochemical values of patients with AIS, healthy control subjects and asymptomatic at risk control subjects*.
Female Male Female + MaIe
Mean Mean Mean
Subject Type N biomarker Range N biomarker Range N biomarker Range P-valuet level (ng/ml) level (ng/ml) level (ng/ml)
OPN Healthy controls 19 580 ±150 318-882 16 558 ± 168 308-856 35 570 ±156 308-882 -
At risk controls 45 829 ±419 208-1834 25 877 ± 378 391 - 1629 70 846 ± 402 208-1834 < 0.001
AIS < 45° 162 774 ± 268 373-1585 27 948 ±335 445-1668 189 799 ± 284 373-1668 < 0.001
AIS ≥ 45° 53 913 ±398 201 - 1821 10 1238 ±409 575-1872 63 965 ± 414 201 - 1872 < 0.001
SCD44 Healthy controls 19 522 ± 99 373 - 829 16 575 ± 92 404 - 800 35 546 ±98 373 - 829 -
At risk controls 45 508 ± 96 316-760 25 533 ± 98 304-510 70 517 ±97 304 - 760 >0.5
AIS < 45° 162 503 ± 161 194-1253 27 527 ±110 364 - 793 189 506 ±155 194-1253 >0.5
AIS ≥ 45° 53 436 ± 251 87 - 882 10 402 ± 216 147-962 63 431 ± 245 87 - 962 0.066
HA Healthy controls 19 128 ± 38 72-236 16 132 ±49 80-255 35 130 ±43 72 - 255 -
At risk controls 45 119±51 36 - 257 25 117±52 33 - 226 70 118±51 33-257 >0.5
AIS < 45° 162 112 ±60 18-356 27 124 ±60 27-283 189 114 ±60 18-356 >0.5
AIS ≥ 45° 53 93 ±40 32 - 222 10 128 ±71 41-25435 63 98 ±48 32-254 0.140
*SD is standard deviation t P-value is from the comparison with healthy control group in all subjects after Bonferroni correction and adjustment for age, gender, and age-gender interaction (OPN and HA) or age (sCD44). After the same adjustments, overall F test p-values for association between group and biomarker levels were < 0.001 (OPN), 0.035 (sCD44), and 0.163 (HA).
[00145] Receiver-operating characteristics (ROC) curves analyzes of plasma OPN comparing the patients with AIS more severely affected (Cobb's angle >45°) with healthy controls showed an AUC of 0.94 with a standard error of 0.03 (95 percent confidence interval 0.88 to 0.99) (see Figure 5A). A cut-off value > 700 nanograms per milliliter gave a sensitivity of 90.6 percent and a specificity of 81.8 percent with (see Figure 5B). A cutoff value >800 nanograms per milliliter had the highest accuracy with a sensitivity of 84.4 percent and specificity of 90.6 percent for confirming scoliosis (minimal false negative and false positive results) (see Figure 5C).
[00146] Although as indicated above, high levels of OPN are found in other adult diseases, high plasma OPN levels found in patients with scoliosis are unique in the pediatric population. The detection of OPN level can thus be used to identify within asymptomatic children those who are at risk of developing a scoliosis (AIS or other spinal disorders and disorders causing scoliosis) and identify among scoliotic subjects, those or are at risk of experiencing a progression of scoliosis. Moreover, plasma OPN levels found in AIS patients were often higher than those measured in adult diseases. OPN levels can also be used to predict the risk in adults (e.g. degenerative scoliosis and idiopathic scoliosis that progress through adulthood). Certain mutations have already been associated with other disorders that may lead to scoliosis. In a particular embodiment, the OPN levels could be used in combination with the detection of these mutations.
EXAMPLE 7
Comparing the level of circulating OPN in asymptomatic children at risk and healthy controls
[00147] A group of 70 asymptomatic children at risk of developing a scoliosis and 35 healthy control subjects were tested as described in Example 1 above. The mean plasma OPN levels in the group at risk of developing a scoliosis (846.30 ± 402 nanograms per milliliter) differed significantly (p=0.001) from the healthy controls (570 ± 156 nanograms per milliliter) and both groups were age- and gender-matched. No significant gender difference was observed (see Table 4 above).
[00148] Using a cut-off value of 800 nanograms per milliliter, it was observed that 47.9 percent of asymptomatic children in that group were above this plasma OPN value while only 8.6 percent of healthy controls were above this value. These results are in
agreement with previous reports showing that the offspring of at least one affected parent develops more often a scoliosis than ones born from unaffected parents (34, 35).
[00149] An enzyme-linked immunosorbent assay (ELISA) or RIA for OPN for instance can thus be used for early identification of subjects at risk of developing a scoliosis for purposes of prognosis and/or scoliotic patients stratification for early bracing and less-invasive surgeries with novel fusionless devices, for pharmacological treatments and to monitor responses to treatment in patients with AIS.
EXAMPLE 8
Comparing the level of circulating sCD44 in AIS patients classified two groups and healthy controls
[00150] Experiments were conducted as described in Example 1 above. The plasma sCD44 and HA levels in healthy controls, both AIS groups and asymptomatic at risk children are displayed in Table 4 above. Comparison among all groups showed no significant change in mean plasma sCD44 and HA values. However, AIS patients exhibiting the most severe spinal deformities (> 45°) had also the lowest mean plasma sCD44 level when compared to the other three groups (p =0.066).
[00151] CD44 and sCD44 can act as a receptor and decoy receptor for OPN respectively. In spite that no significant changes were measured among all groups tested, the most severely affected AIS patients (> 45°) showed the lowest mean sCD44 value among all groups tested., Interestingly, decreased plasma sCD44 levels were found in immunodeficiency and autoimmune diseases(35"37), but none of these conditions normally lead to scoliosis in absence of high plasma OPN levels, suggesting that sCD44 could play a role in AIS as disease-modifying factor by interfering with the action of OPN (see Figure 17).
EXAMPLE 9
Profiles of change in OPN levels, sCD44 levels, and Cobb's angle of AIS patients over time
[00152] The progression of biomarkers (OPN and sCD44 levels) and Cobb's angle was measured over follow up time in AIS patients. Figure 7 presents these progression in 4 selected AIS female patients (not under brace treatment) aged 12 (red), 14 (green
and blue), and 17 (yellow) at baseline visit.
[00153] Figure 8 presents the distribution of total change in OPN (left panel) and sCD44 (right panel) levels over follow-up time in AIS patients with worsened curve deformity (total increase in Cobb's angle greater than 3°) and in those without significant change in curve (no change in Cobb's angle, decrease, or increase smaller than 3°; also presents for all Average change in OPN levels was significantly higher in the group with worsened curve deformity (Wilcoxon rank sum test p<0.01). No significant difference was detected for sCD44 (p>0.5). Length of follow-up time was similar between the 2 groups (p>0.5).
[00154] Figure 9 shows OPN progression correlated with Cobb's angle progression in a group of AIS patients while Figure 10 shows OPN regression or stabilization correlated with Cobb's angle regression or stabilization in other AIS patients;
[00155] OPN level can be used to identify among pre-diagnosed patients those in which scoliosis will progress.
EXAMPLE 10
Profiles of change in OPN levels, sCD44 levels, and Cobb's angle of asymptomatic at risk patients over time
[00156] Figure 11 shows profiles of change in OPN and sCD44 levels angle in 4 selected at risk subjects without scoliosis: one male aged 13 (green), and 3 female aged 5 (gold), 11 (blue), and 9 (red) at baseline visit. Significant inter-subject variability was observed in the baseline levels of biomarkers and change over time among at risk subjects (especially for OPN), indicating the potential of using this biomarker as a tool to monitor onset of scoliosis in at risk subjects.
[00157] Tables 5 to 8 below present the clinical and biochemical profiles in detail for each of the healthy control subjects (Table 5), of the AIS patients with Cobb's angles of less than 45 degrees (Table 6), of the AIS patients with Cobb's angles 45° or more (Table 7), and of the asymptomatic at risk children (Table 8).
Table 5. Clinical and biochemical profile of healthy control subjects.
Date of Collection Timepoint [SCD44]
Random Gender Age [OPN] (ng/ml) [HA] (ng/ml) Birth Date (months) (ng/ml)
1 1996-03-21 M 112 2007-05-22 TO 66392 ± 2603 533.4 16487 ±605
2 1996-06-26 M 109 2007-05-22 TO 41823 ±1249 50438 12049 ±206 116 2008-01-16 T8 59364 ± 2877 555.88 15002 ±1574
3 1996-05-28 F 110 2007-05-22 TO 62952 ± 064 829.35 14089 ± 390 117 2008-01-16 T8 89276 ± 154 507.54 14671 ±2469
4 1996-06-22 M 109 2007-05-22 TO 45868 ±1140 799.57 10098 ±689
5 1996-10-13 F 106 2007-05-22 TO 45933 ± 290 525.76 13984 ±289 11.3 2008-01-16 T8 46446 ± 229 476.43 15736 ±2010
7 1996-08-08 F 108 2007-05-22 TO 69118 ±250 664.38 12069 ±279 115 2008-01-16 T8 82538 ±116 54585 18039 ±4255
8 1996-02-01 M 113 2007-05-22 TO 49886 ± 066 643.38 9924 ± 235 12.0 2008-01-16 T8 46987 ± 1147 440.44 15420 ±253
9 1997-06-28 M 99 2007-05-22 TO 51711 ±5344 58266 13443 ±642
10 1997-07-23 F 98 2007-05-22 TO 75624 ± 2361 499.03 13104 ±198 10.5 2008-01-16 T8 103980 ±310 337.33 16784 ±248
11 1996-02-22 M 11.3 2007-06-06 TO 65309 ±1514 58114 19113 ±1798 118 2007-12-04 T6 521 OO± 582 861.46 26554 ± 697
12 1996-02-09 F 11.3 2007-06-06 TO 44997 ±1121 490.25 11271 ±1795 118 2007-12-04 T6 92312± 103 47609 18880 ±1517
13 1996-05-17 F 11.1 2007-06-06 TO 48830 ± 080 42877 16861 ±949 11.6 2007-12-04 T6 65935 ± 168 584.96 18209 ±1374
14 1995-10-20 M 116 2007-06-06 TO 61077 ±893 573.88 128.40 ± 658 12.1 2007-12-04 T6 46987 ±1912 527.07 16716 ±4448
16 1997-03-07 F 10.2 2007-06-06 TO 54482 ± 791 516.6 13283 ±207 10.7 2007-12-04 T6 72388 ± 856 503.74 65,43 ± 9,60
17 1996-05-09 M 11.1 2007-06-06 TO 45087 ± 641 553.26 25519 ±1461 11.6 2007-12-04 T6 53037 ±1678 267.86 42,33 ± 7,47
18 1997-09-02 F 98 2007-06-06 TO 55541 ±3217 498.65 12724 ±1065
19 1996-11-04 M 106 2007-06-06 TO 31485 ± 993 682.71 17592 ±1620
20 1997-05-30 F 100 2007-06-06 TO 381.57 ±461 373.01 8765 ± 371 105 2007-12-04 T6 43448 ± 573 497.7 14261 ± 842
21 1997-01-07 F 104 2007-06-06 TO 31819 ±662 47459 23576 ± 368
10.9 2007-12-04 T6 393.98 ± 3.87 571.14 209.26 ± 2.40
22 1997-02-09 F 10.3 2007-06-06 TO 882.15 ± 18.31 542.95 131.86 ± 1.13 10.8 2007-12-04 T6 804.46 593.61 120.43 ± 14.60
23 1997-03-02 M 10.3 2007-06-06 TO 307.71 ± 4.88 621.23 157.12 ± 2.29
24 1997-06-19 F 10.0 2007-06-06 TO 423.06 ± 13.90 561.28 149.88 ± 5.65
25 1997-04-12 F 10.1 2007-06-06 TO 758.88 ± 5.74 478.79 169.32 ± 8.25
26 1997-12-02 M 9.5 2007-06-06 TO 441.36 ± 8.32 645.84 148.32 ± 16.36
27 1996-04-03 F 11.2 2007-06-06 TO 794.21 ± 5.50 545.62 77.58 ± 8.87 11.7 2007-12-04 T6 748.79 ± 7.61 575.46 228.08 ± 27.64
28 1995-09-30 F 11.7 2007-06-12 TO 503.25 ± 8.16 451.68 71.91 ± 4.23
29 1996-09-15 M 10.7 2007-06-12 TO 576.62 ± 5.29 554.79 80.24 ± 3.69 11.2 2007-12-04 T6 552.15 598.79 108.09 ± 16.44
30 1996-01-18 F 11.4 2007-06-12 TO 578.62 ± 0.24 634.22 126.21 ± 4.18 11.9 2007-12-04 T6 498.67 ± 8.60 606.57 192.18 ± 31.90
31 1996-08-24 F 10.8 2007-06-12 TO 531.91 ± 4.36 432.2 132.19 ± 5.06 11.3 2007-12-04 T6 455.46 ± 4.85 660.14 244.46 ± 3.49
32 1997-04-19 F 10.1 2007-06-12 TO 611.32 ± 6.46 481.47 92.69 ± 2.87 10.6 2007-12-04 T6 406.38 ± 19.28 415.61 142.80 ± 25.25
33 1997-04-21 M 10.1 2007-06-12 TO 543.15 ± 7.32 403.56 91.82 ± 4.49 10.6 2007-12-04 T6 360.77 ± 9.93 544.36 81.68 ± 23.85
34 1995-11-15 M 11.6 2007-06-12 TO 856.07 ± 3.82 501.71 96.37 ± 4.15 12.1 2007-12-04 T6 922.12 ±20.68 535.71 56.34 ± 1.86
35 1996-04-22 F 11.1 2007-06-12 TO 659.81 ± 5.54 502.09 87.90 ± 4.85 11.6 2007-12-04 T6 596.77 ± 10.14 378.46 242.42 ± 36.30
36 1995-12-09 M 11.5 2007-06-12 TO 816.64 ± 14.56 502.85 83.26 ± 0.12
37 1995-10-07 M 11.7 2007-06-12 TO 805.92 ± 14.01 511.63 80.24 ± 3.69 12.2 2007-12-04 T6 304.61 ± 14.94 489.06 141.51 ±21.50
* Plus-minus values are means ± standard deviations. t Healthy control subjects have no family history of scoliosis and are examined before sample collection by an orthopaedic surgeon.
able 6. Clinical and biochemica profiles of AIS patients with Cobb's angles less than 45°.
149 1988-09-28 M 17.7 2006-06-02 TO 31-26 lTIL — — 472.61 559.97 138.95 ± 7.42
150 1992-10-16 F 13.6 2006-06-02 TO 25 rT — Sister 805.88 543.22 71.24 ± 1.52
151 1993-04-11 F 14.7 2007-12-03 TO 28-20 rTIL — — • 732.19 ± 2.30 403.51 20.80 ± 3.30
152 1990-10-04 F 15.7 2006-06-02 TO 34 IL — Father 655.10 551.24 122.69 ± 0.10
154 1989-11-24 F 16.6 2006-06-08 TO 40 ITL — Cousin 541.07 639.52 104.09 ± 13.96 18.1 2007-12-07 T18 38 ITL 1101.07 ± 38.84 342.17 35.08 ± 5.40
155 1991-01-01 F 15.4 2006-06-08 TO 26 ITL — Aunt 738.59 796.06 121.33 ± 17.72
159 1998-03-04 F 9.7 2007-11-06 TO 3 ITL — Mother 769.50 ± 21.57 831.18 107.5 ± 1.08
161 1994-04-27 F 13.6 2007-11-30 TO 15 ITL — — 487.11 ± 29.43 355.79 23.63 ± 0.53
165 1995-08-30 F 12.3 2007-12-03 TO 34-20 lTIL — — 1148.04 ± 47.51 607.43 42.39 ± 7.68
168 1992-04-24 F 14.2 2006-06-26 TO 16-18 rTIL 810.21 ± 28.48 244.4 103.10 ± 10.39 14.6 2006-11-21 T5 17-16 rTIL 582.52 ± 23.29 338.03 99.20 ± 18.18 15.5 2007-10-01 T16 14-16 rTITL 441.81 ± 7.29 333.4 126.96 ± 1.45
176 1992-10-24 F 13.8 2006-07-03 TO 29 rT 503.88 ± 35.81 331.65 91.50 ± 21.99 14.2 2007-01-15 T6 27 rT 675.38 ± 44.20 305.92 193.26 ± 2.38
183 1991-09-13 M 14.8 2006-05-07 TO 17 rL 733.99 ± 17.33 550.24 72.91 ± 10.68 15.4 2007-06-02 T13 7.-19 rTIL 781.03 ± 3.27 531.96 69.83 ± 7.07
200 1992-07-29 M 15.2 2007-10-30 TO 23-24 rTIL — — 972.10 ± 4.92 401.94 88.41 ± 10.08
201 1992-11-27 F 13.7 2006-07-12 TO 10-17. rTIL — Sister 782.77 ± 2.63 498.93 142.57 ± 44.69
225 1994-05-09 F 12.2 2006-07-24 TO 15-19 ITrTL — — 406.67 ± 3.40 617.37 248.10 ± 24.21 12.8 2007-02-27 T7 13-18 ITrL 651.89 ± 21.69 524.9 47.95 ± 3.60
234 1990-07-16 M 16.2 2006-10-13 TO 26 rT — — 840.88 ± 1.98 491.26 89.04 ± 5.66
586.25 ± 0.32 181.655 ±
235 1991-10-29 M 15 2006-10-13 TO 20 ITL — — 403.8 48.71 16 2007-10-11 T12 18 ITL 523.39 ± 9.76 428.29 188.63 ± 6.83
_ Mother, brother,
240 1993-10-04 F 13.2 2006-12-11 TO 17-23 rTIL 525.88 ± 7.74 428.83 71.91 ± 4.23 cousin
242 1989-09-12 F 17.3 2007-01-12 TO 6 ITL — Sister 590.13 ± 6.00 435.59 80.24 ± 3.69
244 1990-10-20 F 16.2 2007-01-19 TO 27-29 rTIL — — 735.26 ± 4.42 510.44 73.81 ± 6.20 17.3 2008-02-13 T13 NA NA 1293.68 ± 36.92 449.1 44.51 ± 4.81
245 1992-01-27 F 15.0 2007-01-22 TO 31-35 rTIL — — 496.26 ± 3.54 333.97 70.41 ± 0.88 15.8 2007-11-14 T10 28-35 rTIL 363.60 ± 2.97 562.52 54.98 ± 5.08
247 1994-12-18 F 12.1 2007-01-26 TO 9 rTL — Mother, sister 1148.31 ± 2.17 371.29 164.68 ± 23.99 12.8 2007-10-09 T9 6 rTL 806.91 ± 16.69 393.27 141.16 ± 2.62
248 1997-06-16 F 9.6 2007-01-26 TO 9 rL — Mother, sister 1010.38 ± 5.14 443.83 142.95 ± 4.69 10.3 2007-10-09 T9 3 ITL 841.24 ± 18.47 490.2 158.10 ±33.95
249 1991-03-25 F 15.9 2007-02-02 TO 31 ITL — 534.09 ± 7.74 459.52 74.98 ± 0.08 16.4 2007-08-03 T6 NA ITL 340.44 ± 12.89 499.97 132.91 ± 37.20 16.9 2008-02-01 T12 36 ITL 579.65 ± 8.62 413.67 98.93 ± 19.98
250 1992-05-08 F 14.7 2007-02-02 TO 32 ITL — Uncle 688.35 ± 9.46 587.17 74.40 ± 3.75 15.4 2007-10-15 T8 21 ITL 612.19 ± 22.36 540.29 150.73
251 1991-09-05 F 15.4 2007-02-02 TO 40-30 rTIL — — 1146.66 ± 7.34 437.25 80.50 ± 5.24
253 1992-10-18 M 14.3 2007-02-27 TO 31 rT — — 634.83 ± 0.90 486.03 184.50 ± 20.76
254 1991-12-11 F 15.2 2007-03-09 TO 28 ITL — — 701.23 ± 1.92 362.22 72.85 ± 2.66 15.9 2007-11-12 T8 15 ITL 548.26 ± 25.55 538.63 83.17 ± 0.07
256 1996-03-19 F 11.0 2007-03-09 TO 11 ITL — — 575.73 ± 5.49 530.67 97.73 ± 3.00
257 1995-04-15 F 11.9 2007-03-09 TO 6 rTL — Mother 995.77 ± 8.22 468.59 94.49 ± 8.02 12.5 2007-10-16 T7 NA NA 879.54 ± 20.53 421.24 102.11 ± 5.69
258 1990-06-24 M 16.8 2007-03-09 TO 14 rT — — 876.44 ± 9.21 564.15 89.36 ±4.66 17.3 2007-10-02 T8 NA NA 520.58 ± 8.52 483.28 175.81 ± 53.68
259 1994-07-07 F 12.7 2007-03-16 TO 8 ITL — — 1095.11 ± 7.88 397.45 85.33 ± 4.07 13.5 2007-10-15 T7 11 ITL 1050.58 ± 5.08 466.58 139.86 ± 15.48
260 1994-07-07 M 12.7 2007-03-16 TO 6 rTL — — 1084.13 ± 1.82 480.1 127.84 ± 8.13
4- 13.5 2007-10-05 T7 4 ITL 494.25 ± 22.05 401.01 188.45 ± 31.29
261 1997-06-19 F 9.7 2007-03-16 TO 21 IL — 745.79 ± 22.70 568.33 122.95 ± 2.89 10.3 2007-10-17 T7 10 ITL 1150.38 ± 5.64 506.72 206.45± 14.75 10.4 2008-02-06 T11 5 ITL 852.44 ± 31.69 432.45 142.46 ± 27.89
263 1994-10-13 F 12.4 2007-03-20 TO 7.-12 rTIL — — 989.52 ± 4.54 617.16 74.05 ± 5.38
264 1992-05-24 F 14.8 2007-03-20 TO 23-30 rTIL — Uncle 579.22 ± 9.53 580.38 100.39 ± 2.76
265 1993-05-04 F 13.9 2007-03-20 TO 23 IL — — 696.52 ± 8.57 491.96 105.88 ± 7.86 14.5 2007-11-13 T8 11-14. rTIL 848.34 ± 8.38 531.14 106.80 ± 1.16
266 1991-01-25 F 16.2 2007-04-02 TO 34 rTL — — 728.63 ± 5.47 462.66 78.08 ± 1.06 16.8 2007-11-15 T7 34 rTL 392.63 ± 9.28 349.34 73.67 ± 3.30
267 1994-05-14 F 12.9 2007-04-02 TO 5 rTL — — 809.78 ± 2.39 579.14 70.57 ± 2.92 13.5 2007-11-15 T7 5 rTL 925.13 ± 23.50 827.31 59.18 ± 8.22
268 1994-08-17 F 12.6 2007-04-04 TO 12.-4 rTIL — Mother 750.67 ± 17.49 385.93 107.96 ± 12.28
271 1994-11-17 F 12.4 2007-04-13 TO 23 rTL — — 925.40 ± 10.01 482.89 87.43 ± 12.34 12.9 2007-10-15 T6 24 rTL 1087.79 ± 22.62 423.61 186.49 ± 10.22
272 1994-04-14 F 13.0 2007-04-13 TO 22-24 rTIL — Aunt 634.87 ± 15.77 531.54 86.12 ± 1.03 13.6 2007-12-05 T8 14-15 rTIL 515.84 ± 13.88 594.47 30.80 ± 7.99
273 1991-06-30 F 15.8 2007-04-13 TO 25 rTL — — 455.86 ± 7.52 548.8 91.21 ± 10.34
274 1990-02-28 F 17.1 2007-04-17 TO 11.-22 rTIL — — 856.81 ± 23.09 461.61 103.50 ± 8.99
275 1996-04-08 F 11.0 2007-04-19 TO 27-1. rTIL — — 943.57 ± 8.27 469.65 66.73 ± 5.64 11.5 2007-10-15 T6 26-19 rTlTL 339.71 ± 8.66 513.42 159.78 ± 30.24
276 1994-09-26 F 13.1 2007-10-15 TO 19-19 rTIL — — 430.84 ± 16.02 431.09 234.52 ± 26.95
277 1994-11-02 F 12.4 2007-04-19 TO 12 IL — — 724.67 ± 0.64 394.65 96.43 ± 0.04 13.0 2007-11-14 T7 15-13 rTIL 634.03 ± 28.77 659.6 127.07 ± 4.00
278 1992-06-08 M 14.9 2007-05-04 TO 22-14 rTIL — Mother 1045.58 ± 1.10 364.31 106.88 ± 8.57 15.3 2007-10-23 T5 26-28 rTIL 1118.55 ± 3.48 457.48 234.68 ± 24.37
279 1998-09-22 F 8.7 2007-05-30 TO 19 rT — — 978.20 ± 17.94 442.08 85.62 ± 0.14 9.2 2007-10-05 T5 8 rT 851.57 ± 67.60 573.28 64.64
280 1992-12-18 F 14.4 2007-05-30 TO 19 rT — Grand-parents 839.91 ± 4.88 415.23 82.19 ± 6.30 14.9 2007-11-02 T6 24 rTL 930.08 ± 11.55 468.35 63.88 ± 1.83
281 1994-10-17 F 12.6 2007-06-01 TO 11 rT — — 991.09 ± 2.95 522.65 151.89 ± 1.15 13.1 2007-11-09 T5 9 ITL 655.22 ± 54.74 505.44 112.65 ± 14.80
282 1997-09-30 F 9.7 2007-06-13 TO 20 rT — — 732.03 ± 19.20 547.53 138.06 ± 12.04 10.3 2008-01-30 T7 NA NA 1196.46 ± 21.91 487.63 129.70 ± 7.80
286 1994-06-01 F 13.3 2007-09-17 TO 28 ITL — — 499.69 ± 1.97 400.19 130.85 ± 3.82
287 1991-11-15 F 15.8 2007-09-18 TO 11 rTL _ _ 602.68 ± 0.65 418.92 190.43
288 1996-05-13 M 11.3 2007-09-18 TO 20 IL — — 927.74 ± 4.10 533.37 55.21 ± 10.16
289 1992-10-23 F 14.9 2007-09-18 TO 18 rT _ _ 509.91 ± 5.91 362.72 81.33 ± 11.16
290 1993-10-02 F 14.0 2007-09-18 TO 22 rTL — Aunts 498.69 ± 46.68 507.71 127.53 ± 8.29
291 1992-07-10 F 20.9 2007-09-18 TO 25-31 rTIL — — 637.03 ± 7.11 467.8 154.54± 1.72
292 1994-01-23 F 13.7 2007-09-21 TO 20 ITL — Grand-mother 691.71 ± 37.30 581.43 76.54 ± 1.66
293 1993-04-03 F 14.5 2007-09-21 TO 16 rT — — 494.81 ± 7.56 359.46 166.11
295 1991-08-09 M 16.1 2007-09-26 TO 11.-8 rTIL — — 838.72 ± 39.67 405.48 159.20 ± 22.89
296 1992-04-04 F 15.5 2007-09-28 TO 15-18 ITrL _ _ 761.74 ± 25.61 494.27 237.77
297 1997-07-13 M 10.2 2007-09-28 TO 20 IT — Uncle 768.08 ± 6.70 515.45 100.00 ± 9.41
298 1994-11-09 F 12.9 2007-09-28 TO 18-21 rTIL — — 750.91 ± 16.94 348.87 290.06 ± 38.15
299 1990-03-21 F 17.5 2007-10-03 TO 33-43 rTIL — — 625.36 ± 6.80 306.11 135.94 ± 1.36
301 1995-02-06 F 12.7 2007-10-09 TO 13 IT — Grand-mother 948.83 ± 11.23 578.58 150.57 ± 4.40
302 1993-05-07 F 14.4 2007-10-09 TO 14.-12 rTIL — — 873.77 ± 2.17 373.31 230.66 ± 10.50
303 1991-03-29 F 16.5 2007-10-15 TO 14 ITL — — 767.96 ± 29.04 458.27 192.45± 10.19
_ Brother, father, all
304 1991-10-25 F 16.0 2007-10-16 TO 25 IT 493.39 ± 34.21 446.06 185.69 ± 12.07 paternal family
305 1992-02-24 F 15.7 2007-10-19 TO 23 ITL — Mother 533.91 ± 18.09 364.52 123.23± 15.87
306 1994-09-22 F 131 2007-10-19 TO 13-18 rTIL — Mother 101654 ±2375 62332 21602 ± 1904
307 1994-01-25 M 137 2007-10-24 TO 8-11-11 ITrTIL — — 132892 ±150 56935 16508 ±1663
308 1997-05-22 F 104 2007-10-26 TO 8 rTL — Aunts 43039±544 51972 13363 ±1113
309 1996-04-10 F 115 2007-10-26 TO 10 ITL — Mother, cousins 53677± 930 48545 28592 ± 2508
311 1993-05-07 F 145 2007-10-26 TO 17 ITL — — 49318 ±2385 5469 11066 ±959
313 1993-06-04 F 144 2007-10-26 TO 20-18 rTIL — Cousin 53622 ± 465 37949 9952 ± 241
314 1993-03-11 F 146 2007-10-29 TO 24 rL — Mother 93967 ±3716 54966 7811 ±722
315 1993-12-16 F 139 2007-10-31 TO 14 ITL _ _ 53759 ±116 48191 14226 ± 2398
316 1992-10-07 M 151 2007-10-31 TO 28 rT — — 63617 ±231 57605 9421 ± 542
318 1997-05-25 F 104 2007-10-15 TO 11 rTL — Mother 115162 ±3364 63457 11213±2316
319 1993-06-28 F 144 2007-11-06 TO 22 ITL — Cousin 51810 ±2777 66702 7946 ± 689
320 1993-09-24 F 141 2007-11-09 TO 15 rT — — 45254 ±1001 76538 13409 ±2138
321 1992-07-04 F 153 2007-11-09 TO 16 rTL — — 47002 ±1675 37713 11037 ±1277
322 1996-06-01 F 114 2007-11-09 TO 4 ITL — — 56520 ± 4873 49294 9512 ±744
324 1991-04-20 F 166 2007-11-09 TO 19-19 rTIL — — 65993 ± 1439 56252 9861 ± 625
_ Mother, grand¬
325 1994-03-26 F 136 2007-11-09 TO 21 rTL 76148 ± 382 84666 parents 8991 ±1248
326 1994-02-02 M 138 2007-11-13 TO 13 ITL _ _ 145137 ±7712 61735 24072 ± 2774 4-
328 1994-09-24 F 128 2007-11-14 TO 11 ITL — — 58055 ± 2491 87697 17459
329 1996-05-29 F 115 2007-11-14 TO 6 rTL — Mother 87716 ±2708 95341 26912±488
330 1994-02-05 F 138 2007-11-16 TO 12 ITL — — 140338 ± 2098 46543 27956
332 1992-01-26 M 158 2007-11-23 TO 24 ITL __ _ 86414 ±4384 69927 17534 ±3044
333 1993-10-21 F 141 2007-11-23 TO 30 ITL — Cousin 56409 ± 737 76216 14310 ± 3054
334 1993-08-07 F 143 2007-11-23 TO 29-27 rTIL — — 89691 ± 2960 72733 15595 ±3828
335 1996-01-16 F 119 2007-11-23 TO 28-27 rTIL — — 119208 ±1498 83956 16232 ±067
337 1991-09-04 M 162 2007-11-28 TO 24 IL — Sister 91493 ±1071 78828 11415±2571
338 1994-12-31 F 129 2007-11-30 TO 10 ITL — Aunt 53994 ± 135 30142 3844 ± 553
339 1992-03-17 F 157 2007-11-30 TO 25 ITL — Grand-father 74748 ± 920 44412 25392
340 1995-05-21 F 125 2007-11-30 TO 30 ITL — — 74648±4511 49856 25946
341 1996-02-11 F 118 2007-11-30 TO 15-14 rTIL — Cousin 94750 ± 3138 66273 7540±141
342 1993-12-01 F 140 2007-12-07 TO 16 rTL — — 99333 ± 5593 37673 1957 ±563
343 1993-06-29 M 144 2007-12-07 TO 15 rTL — Grand-mother 99661 ± 2586 54176 4348 ± 296
344 1996-03-26 F 117 2007-12-07 TO 10 rTL — — 63778 ± 773 70248 2694 ± 589
345 1993-04-12 F 146 2007-12-07 TO 30 ITL — Cousin 72243 ±1856 42944 3174 ± 177
346 1996-10-11 F 112 2007-12-07 TO 18-17 rTITL — — 57626 ± 2483 43635 2925 ± 256
347 1997-04-07 F 107 2007-12-11 TO 5-6 rTIL — Sister 12721111819 42598 4120 ± 460
348 1995-06-10 M 125 2007-12-11 TO 10 rTL — Sister 77687± 5077 38451 2713 ±184
350 1995-02-22 F 128 2007-12-13 TO 25 rTL — — 102059 ±4663 48819 3235 ±216
351 1992-05-19 F 156 2007-12-13 TO 14 rTL — Father 55714 ±2567 47523 2016 ±276
352 1996-04-13 M 117 2007-12-13 TO 14 rTL — Father 133962 ±3988 56682 9702
353 1993-08-12 M 143 2007-12-13 TO 24 rT — — 156933 ±4327 60743 10559 ±9583
354 1994-06-07 F 135 2007-12-13 TO 8 IT — — 60888 ± 680 43116 6978 ± 4024
355 1993-08-08 F 143 2007-12-13 TO 27 ITL — — 69105 ± 3753 37846 2441 ±1243
356 1995-05-17 F 126 2007-12-13 TO 19 ITL — — 82489 ± 139 46745 4363
358 1997-02-27 F 109 2008-01-11 TO 18 rTL — — 55486 ± 843 38721 11604 ±2253
359 1995-11-08 F 130 2008-01-15 TO 14 rTL — — 70963 ± 385 48594 19532 ±3414
360 1992-05-24 F 156 2008-01-15 TO 14 ITL — Mother 46635 ±1261 33502 15717 ±722
361 1996-06-29 F 115 2008-01-15 TO 23 rTL — Aunt 89931 ±1009 44172 8152 ± 147
362 1997-08-21 F 104 2008-01-16 TO 11 ITL — Grand-mother 47173 ± 2157 43735 11036 ±742
Mother, grand¬
363 1993-05-24 F 146 2008-01-16 TO 20-24-19 ITrTITL — 74310 ±1501 35353 16177 ±2540 mother, aunt
Mother, grand¬
364 1995-03-24 F 128 2008-01-16 TO 10 ITL — 76706 ±1117 46075 16024 ±2697 mother, aunt
Mother, grand¬
365 1999-07-26 F 93 2008-01-16 TO 5 rTL — 88348 ± 232 40341 12781 ±2358 mother, aunt
368 1996-07-12 F 115 2008-01-18 TO 14 rTL — — 120606 ±4370 41524 13662 ±2894
369 1992-05-21 F 157 2008-01-18 TO 25 rTL — — 45471 ±1334 43144 13225 ±1969
370 1994-12-01 F 131 2008-01-18 TO 18-15 rTIL — — 85536 ±1035 3957 14053 ±277
371 1992-02-04 F 160 2008-01-18 TO 26-20 rTITL — Aunt, cousin 74005 ± 538 48774 11207±313
372 1991-06-21 F 166 2008-01-21 TO 23-21 rTIL — — 43658 ± 4088 39561 17065 ±1344
374 1992-05-26 F 157 2008-01-21 TO 25 IL — — 49650 ± 2807 4014 7769 ± 660
375 1992-10-21 F 153 2008-01-22 TO 31-55 rTITL — — 47588 ± O OO 38569 13095 ±380
376 1993-05-18 F 147 2008-01-22 TO 16 rTL — — 55483 ± 4465 38761 7378 ±015
377 1995-01-31 F 130 2008-01-22 TO 27 ITL — — 73947 ± 803 38416 7940±115
379 1996-09-14 F 114 2008-01-25 TO 5-5 ITrTL — — 140412 ±6684 65932 7873 ± 262
381 1992-01-11 M 160 2008-01-25 TO 24 rT — — 78227 ± 142 50565 28301 ± 2697
382 1993-10-21 F 142 2008-01-25 TO 28-25 rTITL — — 99895 ±912 32782 7764 ±1298
383 1994-11-20 F 132 2008-01-25 TO 30-27 rTITL — — 90032 ± 2408 40179 8398 ± 731
384 1992-02-09 M 160 2008-01-29 TO 25-19 rTIL — — 47970 ± 3672 44482 13493 ±783
386 1994-09-02 F 134 2008-02-01 TO 25-14 ITrT — — 73299 ± 2862 63786 12978 ±215
387 1994-04-11 F 13.8 2008-02-01 TO 14-15 rTITL — Cousin 853.05 ± 70.97 373.81 146.21 ± 6.37
388 1995-11-24 F 12.2 2008-02-01 TO 34 rT — — 963.01 ± 40.86 465.02 66.49 ± 7.43
389 1997-04-13 F 10.8 2008-02-04 TO 14 ITL — Father 689.25 ± 35.56 435.9 67.38 ± 15.52
390 1994-04-28 F 13.8 2008-02-04 TO 28-26 rTIL — Father 930.28 ± 18.25 368.83 56.32 ± 0.12
391 1994-07-01 F 13.6 2008-02-05 TO 37 rTL — — 540.38 ± 9.17 501.81 49.99 ± 7.23
392 1998-11-25 F 9.2 2008-02-05 TO 16 rTL — Brother 661.55 ± 38.23 412.14 77.84 ± 23.22
393 1993-09-30 M 14.3 2008-02-05 TO 26 rTL — Brother 1235.01 ± 29.98 488.02 106.86 ± 17.43
395 1995-05-24 F 12.7 2008-02-08 TO 11 rT — Mother 716.48 ± 30.93 496.45 82.74 ± 2.92
Mother, grand¬
397 1999-02-20 F 9.0 2008-02-08 TO 10 rTL — 751.57 ± 2.34 543.59 85.71 ± 21.81 mother
Mother, grand¬
398 1997-09-16 F 10.4 2008-02-08 TO 16 rTL — 872.92 ± 6.46 526.34 98.45 ± 6.33 mother
399 2000-09-28 M 7.4 2008-02-08 TO 22-20 rTITL — — 444.55 ± 43.23 481.5 74.45 ± 10.16
400 1994-05-25 F 13.7 2008-02-08 TO 12 rTL — Mother, aunt 1492.58 ± 30.46 477.59 135.22 ± 2.80
401 1994-02-17 F 14.0 2008-02-18 TO 28-21 rTITL — — 691.24 ± 23.14 316.38 50.01 ± 1.95
402 1991-07-15 F 16.6 2008-02-14 TO 19-12 rTIL — — 423.93 ± 1.08 314.48 36.64 ± 2.04
403 1995-02-21 F 13.0 2008-02-14 TO 13-13 rTITL — Sister 1216.81 ± 131.72 354.37 52.43 ± 15.76
1264 1997-09-22 F 15.2 2005-04-18 TO 40 rTL 2005-04-18 — 616.12 578.96 65.92
1276 1997-09-23 F 15.2 2005-05-16 TO 42 IT 2005-05-16 — 817.56 450.13 107.62 ± 12.96 VO
1364 1997-09-24 M 14.9 2006-04-24 TO 44 ITL 2006-04-24 Sister, aunt 1668.06 407.4 80.85 ± 6.90
1365 1990-05-11 F 15.9 2006-04-26 TO 23-53 ITrL 2006-04-26 — 947.35 642.66 63.18 ± 5.41
1366 1993-04-06 F 13.1 2006-05-01 TO 36 NA 2006-05-01 — 1317.97 323.04 89.70 ± 20.57
1373 1991-10-07 F 14.6 2006-05-17 TO 41-48 rTIL 2006-05-17 — 1584.54 583.14 80.12 ± 18.75
1380 1989-10-09 F 16.7 2006-06-26 TO 35 rL 2006-06-26 — 1289.98 602.35 139.38
1384 1991-01-17 F 15.5 2006-07-03 TO 41 ITL 2006-07-03 1502.51 ± 18.63 194.3 121.65 ± 44.94 15.8 2006-11-15 T4 9-4 1258.85 ± 16.20 448.68 162.01 ± 11.64
1385 1990-06-12 F 16.1 2006-07-04 TO 42-23 rTIL 2006-07-04 — 1098.75 523.52 102.35
1387 1991-07-15 F 15.0 2006-07-17 TO 29-37-35 rTIL 2006-07-17 Mother 1017.47 689.52 78.42
1388 1991-12-13 F 14.6 2006-07-19 TO 38 rTL 2006-07-19 — 1080.53 811.37 87.57
1409 1993-02-11 F 13.6 2006-09-26 TO 40 rT 2006-09-26 — 499.41 ± 67.54 389.14 113.56 ± 15.03
1433 1992-07-03 F 14.5 2007-01-10 TO 44 rT 2007-01-10 Uncle 459.61 ± 17.79 287.42 263.55 ± 34.89
1451 1995-01-13 F 12.2 2007-03-14 TO 42 rT 2007-03-14 Grand-mother 1099.93 ± 48.11 290.5 158.45 ± 3.94
1478 1990-08-06 F 16.8 2007-06-11 TO 41 rTL 2007-06-11 Father 619.94 ± 46.51 251.56 190.25 ± 18.46
1481 1990-08-15 F 16.8 2007-06-18 TO 40 rT 2007-06-18 — 748.36 ± 9.30 250.14 95.34 ± 6.52
1483 1989-06-26 F 18.0 2007-06-19 TO 37-25 rTIL 2007-06-19 — 489.30 ± 93.18 396.39 167.02 ± 28.62
I 1487 1990-05-30 F 17.1 2007-07-03 TO 35-58-35 ICrTIL 2007-07-03 Aunts 508.82 ± 50.08 281 ,48 17.75 ± 1 ,94 |
* Plus-minus values are means ± standard deviations. ** All patients are diagnosed with AIS t Curve type nomenclature: r, right/ 1, left/ T, Thoracic/ L, Lumbar/ TL, Thoracolumbar/ C, Cervical.
$ Certain clinical information may not have been available at the time of the study, NA.
Ul
O
Table 7. Clinical and biochemical profiles of AIS patients with Cobb's angles of 45° or more.
Cobb's
Patient Date of Collection Timepoint Angle Curve Date of [SCD44] ID Birth Gender Age Date (months) Pre-op Type Surgery Family History [OPN] (ng/ml) (ng/ml) [HA] (ng/ml)
101 1988-05-22 F 17.1 2005-06-10 TO 47 rT 1047.64 728.42 221.97 ± 8.23
108 1989-08-29 F 15.9 2005-07-04 TO 45 IL — — 774.45 704.05 86.15 ± 12.73 17.2 2006-11-21 T16 40 IL 414.67 ± 55.62 361.83 172.00 ± 3.68
135 1987-12-31 F 18.0 2006-01-13 TO 47-30 rTIL 657.01 839.02 117.48 ± 5.37
145 1990-02-15 M 16.2 2006-04-21 TO 50-43 rTITL — Brother 1178.85 961.85 120.52 ± 8.59
170 1991-07-08 F 14.9 2006-06-26 TO 53-22 rTIL 2007-08 Aunt 480.97 ± 29.49 317.2 33.76 ± 0.92 15.9 2007-04-18 T10 44-21 rTIL 540.63 1 10.65 410.66 70.69 ± 4.67
Mother, grand¬
1150 1992-04-18 F 12.1 2004-05-11 TO 84 rT 2004-05-11 mother 884.02 874.59 97.74
1169 1989-09-19 F 14.8 2004-06-22 TO 54-52 rTIL 2004-06-22 — 776.13 868.43 101.22 ± 9.41
1192 1990-10-16 F 13.9 2004-09-08 TO 59 rT 2004-09-08 1140.09 596.41 66.97
1212 1991-05-06 F 13.5 2004-11-22 TO 54 rT 2004-11-22 Great-aunt 834.47 796.56 75.57
1254 1991-07-23 F 13.7 2005-03-16 TO 52-49 rTIL 2005-03-16 1091.92 882.29 82.8
1267 1990-09-08 F 14.6 2005-04-25 TO 55 IT 2005-04-25 — 509.48 596.41 76.87
Ul
1282 1988-12-29 F 16.5 2005-06-06 TO 49 rT 2005-06-06 718.45 788.41 53.95 ± 16.65
1310 1990-05-05 F 15.6 2005-11-09 TO 55-42 rTIL 2005-11-09 — 1042.25 789.32 132.89
1353 1989-08-08 F 16.6 2006-03-27 TO 46 IT 2006-03-27 — 1078.92 ± 33.32 262.59 90.88 ± 1.59 17.2 2006-10-06 T7 2 NA 44.35 ± 0.50 342.48 157.74 ± 37.90
1354 1991-11-18 F 14.3 2006-03-27 TO 45 rT 2006-03-27 1378.360 725.138 61.016
1355 1990-02-26 M 16.1 2006-03-28 TO 74-53 rTIL 2006-03-28 — 1871.67 467.38 253.56 ± 6.84
1357 1990-08-23 F 14.8 2005-06-15 TO 47-50 rTIL 2006-04-04 Brother 705.92 ± 16.09 415.22 174.61 ± 74.40 15.7 2006-04-04 T10 57-50 rTIL 1788.1 374.7 76.86 ± 4.78
1360 1996-05-09 F 9.9 2006-04-10 TO 53-46 rTIL 2006-04-10 Father, aunt 1820.95 444.42 80.45 ± 29.61
1361 1989-09-03 F 16.6 2006-04-10 TO 65-95 rTIL 2006-04-10 1512.16 599.64 67.13 ± 10.66
1369 1992-02-19 F 14.2 2006-05-09 TO 88 rT 2006-05-09 — 1498.66 262.58 91.42 ± 8.52 14.8 2006-11-24 T6 25 NA 541.43 ± 10.31 317.72 166.79 ± 35.56
1371 1991-01-30 F 15.3 2006-05-15 TO 72-59 rTIL 2006-05-15 — 1723.91 224.15 89.53 ± 18.60
63-45-
1372 1990-09-06 F 15.7 2006-05-16 TO 33 rTLILC 2006-05-16 Aunt 1016.66 597.2 65.24 ± 5.40
1374 1989-10-05 F 16.6 2006-05-29 TO 45 ITL 2006-05-29 1698.01 544.71 70.32 ± 16.24
1378 1992-12-14 M 13.5 2006-06-05 TO 70 ITL 2006-06-05 — 1531.64 394.74 249.97
1381 1990-10-03 F 15.7 2006-06-27 TO 66 IT 2006-06-27 1032.61 626.25 89.25
1389 1995-10-26 F 10.7 2006-07-24 TO 46-66 rTITL 2006-07-24 — 899.76 ± 20.49 359.31 187.61 ± 62.69 11.0 2006-10-02 T5 NA NA 770.91 ± 13.31 533.42 82.67 ± 1.55
1390 1990-12-12 F 15.6 2006-07-24 TO 53 ITL 2006-07-24 — 1269.89 839.02 78.42
Grand-mother,
1392 1993-05-25 F 13.2 2006-07-26 TO 48 rT 2006-07-26 aunts 1341.80 ± 15.38 87.13 105.48 ± 0.34
1393 1991-05-09 F 15.2 2006-07-26 TO 56 ITL 2006-07-26 — 969.63 821.21 81.59
1395 1988-10-25 F 17.8 2006-08-08 TO 84 ITL 2006-08-08 Aunt 1205.3 450.13 41.8
1396 1995-05-27 F 11.2 2006-08-14 TO 74-62 rTIL 2006-08-14 — 1624.64 ± 5.10 166.83 172.75 ± 26.23 11.3 2006-09-26 T1 NA NA 773.40 ± 16.42 342.29 218.18 ± 2.83
1397 1988-12-23 M 17.7 2006-08-29 TO 60-58 rTIL 2006-08-29 Uncle 1581.40 ± 11.23 440.95 106.21 ± 10.20 17.9 2006-10-11 T2 34-23 NA 1191.01 ± 14.64 546.18 158.77 ± 21.05
1406 1991-10-29 F 14.9 2006-09-20 TO 62-60 rTIL 2006-09-20 — 628.36 ± 45.23 304.04 52.88 ± 0.66
1410 1993-01-04 F 13.7 2006-09-28 TO 56 rT 2006-09-28 Mother, aunt 1287.16 ± 3.12 133.56 119.48 ± 24.22 13.8 2006-11-21 T2 23 NA 903.57 ± 52.88 328.75 141.76 ± 12.56
1416 1991-07-10 F 15.4 2006-11-15 TO 56-30 rTIL 2006-11-15 514.30 ± 15.49 233.55 121.42 ± 28.69
1420 1993-06-30 F 13.4 2006-11-29 TO 60-48 rTIL 2006-11-29 Sister, aunt 661.35 ± 21.22 314.01 127.14 ± 1.06
1422 1994-06-27 F 12.4 2006-12-06 TO 60-50 rTIL 2006-12-06 Sister 530.56 ± 6.57 190.55 61.30 ± 14.49
1430 1989-09-28 F 17.3 2007-01-03 TO 48 rT 2007-01-03 — 533.56 ± 24.89 228.54 51.29 ± 7.00 K*
1442 1994-08-21 F 12.5 2007-02-14 TO 60 rT 2007-02-14 — 512.99 ± 44.58 163.01 162.44 ± 3.03
1446 1988-07-10 F 18.6 2007-02-26 TO 60 rT 2007-02-26 — 537.87 ± 4.70 332.42 66.44 ± 20.48
1448 1992-12-07 F 14.3 2007-03-13 TO 49 ITL 2007-03-13 — 588.73 ± 25.88 110.3 138.81 ± 10.07
1457 1993-05-30 F 13.9 2007-04-10 TO 50-43 rTIL 2007-04-10 — 1073.67 ± 69.04 401.79 83.21 ± 0.17
1458 1991-09-27 F 15.4 2007-04-11 TO 45 rT 2007-04-11 — 401.08 ± 22.88 212.16 66.48 ± 0.55
1459 1990-03-28 F 17.1 2007-04-16 TO 72-36 rTIL 2007-04-16 — 761.78 ± 11.69 104.61 42.08 ± 5.99 17.2 2007-05-18 T1 NA NA 744.34 ± 10.91 340.71
1461 1990-05-17 F 16.9 2007-04-18 TO 48 rT 2007-04-18 Sister 200.53 ± 3.68 371.51 112.29 ± 27.44
1464 1990-01-02 F 17.3 2007-04-25 TO 53 rT 2007-04-25 — 778.26 ± 19.40 163.01 133.86 ± 4.16
1467 1990-11-18 F 16.5 2007-05-08 TO 60 rT 2007-05-08 — 453.32 ± 17.32 236.23 48.59 ± 6.73
1468 1991-11-12 M 15.5 2007-05-14 TO 69 rTL 2007-05-14 Cousin 574.80 ± 42.46 283.37 116.85 ± 14.54
1471 1989-10-08 F 17.6 2007-05-29 TO 60 rTL 2007-05-29 — 907.06 ± 34.13 332.42 66.91 ± 28.51
1474 1989-06-24 M 18.0 2007-06-04 TO 54-52 rTIL 2007-06-04 — 1254.39 ± 4.53 334.72 71.72 ± 16.08
1477 1992-10-17 F 14.6 2007-06-06 TO 62-65 rTIL 2007-06-06 Mother, brother 829.32 ± 15.89 355.03 150.57 ± 28.87
1484 1991-04-27 F 16.2 2007-06-26 TO 60 rT 2007-06-26 — 489.15 ± 20.09 216.67 88.54 ± 422
1488 1992-02-17 M 15.4 2007-07-16 TO 87 rT 2007-07-16 Mother 1358.23 ± 56.62 304.83 120.78 ± 13.25
1489 1990-09-26 M 16.8 2007-07-17 TO 57 rT 2007-07-17 — 1417.61 ± 0.00 146.93 135.42 ± 2.53
1495 1992-03-19 F 15.5 2007-09-17 TO 67-39 rT 2007-09-17 — 437.55 ± 14.74 227.82 32.06 ± 0.29
1498 1992-11-05 F 14.9 2007-09-18 TO 51-42 rTL 2007-09-18 — 557.43 ± 50.58 152.3 62.63 ± 12.90
1501 1989-02-04 F 16.5 2005-07-22 TO 58 rTL — — 939.53 711.38 144.30 ± 16.14 17.8 2006-11-21 T16 60 rTL 580.11 ± 7.56 503.43 107.24 ± 7.29
1502 1994-03-14 F 13.6 2007-10-15 TO 55-43 rTIL 2007-10-15 — 856.14 ± 4.95 386.19 152.27 ± 5.09 13.8 2007-12-05 T2 NA NA 1089.57 ± 22.51 349.14 55.91 ± 10.45
1506 1992-07-07 F 15.3 2007-11-06 TO 65 rT 2007-11-06 — 675.53 ± 13.63 241.98 85.64 ± 24.87
1517 11/20/1990 M 17.2 2008-02-13 TO 50-62 rTITL — 666.49 ± 65.68 328.96 41.3 ± 8.74
1518 12/8/1991 F 16.2 2008-02-13 TO 62-62 rTIL — — 672.59 ± 35.53 440.55 67.71 ± 6.81
1519 1993-04-19 M 14.8 2008-02-08 TO 51 rT — 945.23 ± 53.53 360.02 66.48 ± 1.10
1520 1993-06-26 F 14.6 2008-02-08 TO 54-42 rTITL — — 752.87 ± 23.12 288.35 87.08 ± 0.36
* Plus-minus values are means ± standard deviations.
** All patients are diagnosed with AIS t Curve type nomenclature: r, right/ 1, left/ T, Thoracic/ L, Lumbar/ TL, Thoracolumbar/ C, Cervical. t Certain clinical information may not have been available at the time of the study, NA.
Ul
Table 8. Clinical and biochemical profiles of asymptomatic at risk children.
Collection Timepoint [SCD44]
Family Id Date of Birth Gender Age Date (months) Family History [OPN] (ng/ml) (ng/ml) [HA] (ng/ml)
1 1997-09-02 M 8.8 2006-07-10 TO Mother 439.72 ± 12.32 561.46 118.71 ± 8.74
1 1995-09-06 F 10.8 2006-07-10 TO Mother 207.88 ± 0.93 315.67 180.71 ± 19.91
Mother, uncle, grand¬
2 1998-02-08 F 8.7 2006-10-03 TO father 1650.21 ± 13.90 416.99 199.56 ± 55.60
9.2 2007-04-19 T6 1966.98 ± 1.96 459.89 207.57 ± 39.18
9.8 2007-12-12 T14 1816.83 ± 24.08 387.1 209.86 ± 21.38
Mother, uncle, grand¬
2 2001-06-18 M 5.8 2007-04-19 TO father 493.98 ± 7.26 463.68 43.99 ± 3.74
6.5 2007-12-12 T8 684.54 ± 10.06 438.94 102.21 ± 61.17
3 1994-08-24 F 12.2 2006-10-19 TO Sister 690.58 ± 2.92 418.18 220.8
12.6 2007-05-02 T7 727.27±17.36 467.79 196.82 ± 18.74
13.2 2007-12-12 T14 1212.32 ± 0.48 311.06 279.74 ± 30.33
4 2003-10-17 F 3.0 2006-10-19 TO Mother 1530.90 ± 28.42 478.58 225. 02 ± 20.51
3.5 2007-04-11 T6 1021.07 ± 7.22 464.63 122.36 ± 15.35
4.2 2007-12-12 T14 1594.42 ±23.36 470.05 332.11
5 2003-07-17 M 3.2 2006-10-19 TO Mother 905.58 ± 30.14 563.44 58.88 ± 3.86
3.7 2007-04-19 T6 1865.13 ± 7.35 434.93 128.14 ± 4.00
4.4 2007-12-09 T14 960.14 ± 26.22 631.93 32.64 ± 5.81
6 1998-07-26 F 8.2 2006-10-19 TO Mother 505.03 ± 8.92 564.17 81.86 ± 13.18
7 1995-06-16 F 11.3 2006-10-24 TO Mother 548.59 ± 6.61 512.92 80.39 ± 31.53
11.8 2007-04-11 T6 766.85 ± 5.73 396.69 103.31 ± 22.50
12.3 2007-10-17 T12 596.91 ± 35.50 465.36 122.40± 8.97
8 1996-04-10 F 10.5 2006-10-26 TO Mother 1109.78 ± 47.61 401.66 77.16 ± 9.72
11 2007-04-11 T6 875.81 ± 14.01 366.36 176.96 ± 4.68
9 1995-05-09 F 11.4 2006-10-26 TO Mother 1657.97 440.3 112.58 ± 0.45
11.9 2007-04-11 T6 782.29 ± 1.47 429.56 86.57 ± 1.46
12.8 2008-02-13 T16 885.10 ± 35.98 255.6 63,42 ± 7,99
10 2002-08-03 F 4.2 2006-10-26 TO Mother 901.66 ± 12.01 398.27 158.65 ± 60.85
4.7 2007-04-11 T6 929.42 ± 3.07 356.88 167.19 ± 0.13
11 1992-09-07 F 14.1 2006-10-26 TO Mother 528.00 ± 8.83 469.78 69.05 ± 4.37
14.8 2007-07-11 T9 714.79 ± 14.44 383.1 37.97 ± 3.99
15.3 2008-01-23 T15 443.30 ± 0.58 472.69 80.27 ± 11.45
12 1991-12-15 F 14.8 2006-10-26 TO Mother 818.88 ± 0.94 518.03 134.08 ± 84.67
15.3 2007-04-11 T6 648.15 487.38 140.02 ±50.63
15.9 2007-11-14 T13 398.28 ±19.81 521.44 191.07 ±8.20
12 1996-02-23 M 10.7 2006-10-26 TO Mother 1203.88 ±55.29 681.23 85.30 ± 36.75
11.2 2007-04-11 T6 1930.95 ±1.96 633.37 107.10 ±15.99
11.8 2007-11-14 T13 1341.78 ±31.57 687.61 170.54 ±25.46
13 1993-10-09 F 13.0 2006-10-26 TO Mother, grand-mother 730.44 ± 33.95 397.12 41.87 ±4.55
13.6 2007-05-02 T7 420.91 ± 23.59 412.49 216.75 ±27.71
14.1 2007-11-14 T13 943.64 ±1.96 698.95 124.28 ±15.03
14 2001-09-07 F 5.2 2006-11-16 TO Father 919.94 ±11.91 510.08 45.28 ±10.89
15 1997-02-18 M 9.8 2006-11-16 TO Mother 1629.22 ±12.49 611.25 129.80 ±30.80
10.2 2007-04-11 T5 1030.34 ±6.55 690.56 146.19 ±2.58
10.7 2007-10-10 T11 929.36 ±11.23 590.8 135.89 ±18.75
16 2002-02-21 F 4.8 2006-11-16 TO Mother 1834.30 ±4.16 628.94 149.05 ±19.17
5.2 2007-04-11 T5 909.22 ± 6.67 661.18 125.31
5.9 2007-12-12 T13 877.48 ± 23.75 466.59 70.10 ±33.68
17 2000-03-30 F 6.7 2006-11-16 TO Mother 482.76 ±10.64 678.55 95.92 ±18.21
18 2000-08-01 F 6.2 2006-11-16 TO Mother 870.73 ±21.30 644.62 146.12 ±36.68 Ul Ul
18 1997-05-05 M 9.5 2006-11-16 TO Mother 1123.32 ±7.06 401.66 112.68 ±11.34
20 1998-09-27 F 8.2 2006-11-22 TO Father 506.21 ± 10.03 456.42 59.40 ± 30.21
8.8 2007-07-11 T8 677.71 ±13.95 416.28 37.11 ±6.95
21 (015) 1998-11-17 F 8.0 2006-11-22 TO Sister 482.63 ± 7.58 458.02 99.16 ±5.46
8.5 2007-05-23 T6 511.46 488.33 151.08
9.0 2007-11-14 T12 760.00 ± 3.99 589.62 190.77±5.64
21 (016) 1991-08-13 F 15.2 2006-11-22 TO Sister 617.06 ±7.65 511.71 110.15 ±12.37
15.7 2007-05-23 T6 619.60 ±17.63 519.3 93.16 ±0.39
16.2 2007-11-14 T12 685.18 ±0.80 529.63 218.26 ±27.22
22 1992-05-15 M 14.5 2006-11-22 TO Mother, grand-mother 1082.23 ±65.01 445.66 81.35 ±14.77
14.9 2007-04-11 T5 1044.90 ±3.21 432.72 152.54 ±10.62
15.6 2008-01-23 T14 1010.18 ±60.70 384.16 106.42 ±10.80
23 (334) 1994-09-24 F 12.2 2006-11-29 TO Sister 1365.94 ±1.71 346.45 150.14 ±2.53
12.6 2007-04-19 T5 1856.82 ±12.74 501.92 167.91 ± 17.19
13.1 2007-10-10 T11 947.97 ±16.31 489.38 271.36± 20.40
24 1994-11-24 M 12.0 2006-11-29 TO Mother, aunt 775.28 ± 20.77 427.49 84.54 ±0.14
12.5 2007-05-02 T6 610.29± 10.86 436.82 130.53 ±2.30
13.1 2007-12-12 T13 718.55± 5.97 355.99 127.92 ± 3.93
24 1994-11-24 F 12 2006-11-29 TO Mother, aunt 815.81 ± 22.25 473.76 160.63 ± 8.36
12.5 2007-05-02 T6 673.56 ± 16.29 445.36 127.40 ± 37.13
13.1 2007-12-12 T13 1299.89 ± 28.77 662.73 276.97
25 1998-06-05 F 8.4 2006-11-29 TO Mother, father 1245.41 ± 13.75 441.4 108.75 ± 18.90
8.8 2007-04-19 T5 1766.40±2.69 500.34 197.20 ± 31.62
9.3 2007-10-10 T11 944.99 ± 25.37 476.76 115.66 ± 10.09
25 2001-06-04 M 5.4 2006-11-29 TO Mother, father 1181.70 ± 50.65 303.75 157.81 ± 11.99
5.8 2007-04-19 T5 1707.51 ± 30.62 319.63 113.24 ± 2.45
6.3 2007-10-10 T11 867.79 ± 25.36 364.76 114.76 ± 33.42
26 1994-03-18 F 12.7 2006-11-29 TO Mother 676.95 ± 9.57 432.08 86.09
27 1987-12-13 F 19 2006-12-19 TO Father 287.27 ± 8.96 572.38 101.88 ± 13.89
28 2003-05-23 F 3.6 2006-12-19 TO Mother 612.92 ± 3.03 760.08 45.57 ± 3.40
29 1990-10-17 M 16.2 2006-12-19 TO Mother 459.54 ± 29.16 488.33 99.03 ± 54.21
17.0 2007-10-10 T10 505.24 ± 39.04 441.73 121.53 ±15.54
29 (652) 1999-05-11 F 7.6 2006-12-19 TO Mother 576.64 ± 20.73 656.77 114.39
8.4 2007-10-10 T10 972.66 ± 7.97 636.32 138.53±16.69
29 (160) 1996-12-02 F 10.0 2006-12-19 TO Mother 583.62 ± 19.18 600.16 136.79±10.66
10.8 2007-10-10 T10 874.79 ± 2.17 535.48 112.73±7.74
30 1995-03-09 M 11.8 2006-12-19 TO Mother 1608.98 ± 8.37 607.15 115.19 ± 6.27
12.3 2007-07-04 T7 1107.95 ± 0.53 504.15 40.04 ± 11.63
12.8 2008-01-23 T13 1578.17 ± 18.50 469.62 93.33 ± 3.68
30 1997-06-08 F 9.5 2006-12-19 TO Mother 1211.80 ± 5.47 586.43 172.18 ± 4.00
10.1 2007-07-04 T7 774.18 ± 21.15 534.59 40.03 ± 11.95
10.6 2008-01-23 T13 697.49 ± 12.25 473.45 95.89 ± 6.16
Mother, aunt, grand¬
31 1998-03-18 F 8.8 2006-12-19 TO father 467.80 ± 1.39 574.23 106.48 ± 29.19
Mother, aunt, grand¬
31 1999-11-03 M 7.1 2006-12-19 TO father 745.53 ± 40.56 552.66 98.22 ± 1.18
32 2004-06-20 F 2.5 2006-12-19 TO Mother, grand-mother 1573.79 ± 0.72 576.5 142.70 ± 0.57
3.1 2007-07-04 T7 1034.97 ± 25.55 494.82 52.38 ± 5.01
3.6 2008-01-23 T13 1237.94 ± 48.60 374.2 152.27 ± 0.32
33 1996-05-17 M 10.7 2007-01-10 TO Mother 623.78 ± 2.66 649.44 166.16 ± 32.22
11.5 2007-11-07 T10 671.14 ± 0.27 634.5 36.87 ± 2.05
33 1996-06-25 F 11.2 2007-01-10 TO Mother 893.13 ± 34.21 436.86 92.74 ± 2.45
117 2007-07-11 T6 71631 ±2752 54359 3795 ± 533
34 1996-08-14 F 103 2006-12-21 TO Mother 113580 ±1820 50895 25664 ±3718 108 2007-06-13 T6 59441 ± 037 49061 9656 ± 245 114 2008-01-23 T13 97810 ±4946 45046 10367 ±1095
34 1994-06-21 M 125 2006-12-21 TO Mother 101070 ±2234 41671 17233 ±5068 130 2007-06-13 T6 73931 ± 343 49904 9355 ± 690 136 2008-01-23 T13 77722 ± 3978 44893 9270 ± 2191
35 (60S) 1995-03-31 M 118 2006-12-21 TO Mother 112622 ±4608 55237 16366 ±079
35 (604) 1995-03-31 M 118 2006-12-21 TO Mother 93316 ±1420 43743 11857 ±665
35 1993-05-12 F 136 2006-12-21 TO Mother 167945 43658 12845 ±1760
36 1998-09-06 M 83 2007-01-10 TO Mother 152081 ±2048 48539 22568 ± 8559 92 2007-11-14 T10 110350 ±2707 89987 11496 ± 011
37 2001-07-11 F 55 2007-01-17 Mother 41951±1021 52402 3552 ± 052 60 2007-07-04 60610 ± 1432 49091 20923
38 1995-01-19 M 120 2007-01-17 TO Mother 43587 ± 738 60034 16449 ±1001
38 1992-08-02 F 144 2007-01-17 TO Mother 32867 ± 2567 56458 16619 ±253
39 1996-06-08 M 106 2007-01-24 TO Mother 43790 ± 2391 52914 21553 ±7015 Ul 111 2007-07-18 T6 61726 ±545 44515 14608 ±882
39 1997-08-08 F 94 2007-01-24 TO Mother 39982 ±1471 45238 71339 ± 2251 HH - - 99 2007-07-18 T O σ> o) O O6) O 64828 ± 630 46201 18878±1279
40 1996-05-05 F 109 2007-04-05 TO Mother 98626 ± 988 47827 999
40 1999-04-23 M 80 2007-04-05 TO Mother 85199 ± 404 71005 5281 ±1217
41 1995-03-29 F 122 2007-05-30 TO Father 50068 ± 2008 41656 7127 ± 030
42 1996-07-03 M 108 2007-05-02 TO Father 39138 ± 3003 62065 3283 113 2007-11-14 T6 39323 ± 422 44578 16725 ±2797
42 1992-04-14 F 151 2007-05-02 Father 45243 ± 168 51981 3846 ±1602 156 2007-11-14 65895 ± 162 93889 23291±200
43 2001-11-20 F 55 2007-05-23 TO Mother 89270 ± 2123 48489 9765 ± 3081
44 1995-09-11 M 118 2007-06-13 TO Mother 105859 ±611 5478 4115 ±1108 122 2007-12-12 T6 116010± 1616 45622 14561 ± 5130
45 1994-05-10 F 132 2007-08-29 Mother 71466 ±688 48212 12000 ±1364 138 2008-02-13 80153 ± 4246 35864 134,84 ±16,18
46 1999-11-04 M 78 2007-09-12 TO Mother 60375 ±1096 56962 11195 ± 586
46 (980) 1996-04-15 F 114 2007-09-13 TO Mother 50438 ± 3585 54029 11825±911
46 (982) 2004-01-24 F 37 2007-09-12 TO Mother 71872 ±7898 51097 15313 ±450
47 1996-12-07 F 108 2007-10-17 TO Mother 101010±1702 49412 14700±8736
47 1999-04-03 M 85 2007-10-17 TO Mother 84483 ± 3084 4567 15633±5036
C6 1997-02-06 F 103 2007-05-22 TO Mother 66960 ±419 75565 13368 ±410 110 2008-01-16 T8 73330 ±1116 62067 25052 ± 3811
C15 1997-05-27 M 100 2007-06-06 TO Brother 44181 ± 064 64033 10653 ±188 105 2007-12-04 T6 44469 ± 382 95824 15186 ±1741
* Plus-minus values are means ± standard deviations t All subjects are examined before sample collection by an orthopedic surgeon to monitor possible scoliosis development
OC
EXAMPLE 11
OPN, sCD44 and HA levels in non AIS scoliotic patients
[00158] OPN levels were measured in non AIS scoliotic patients (NAIS patients). Results are summarized in Table 9 below. A comparison of OPN, sCD44 and HA levels in healthy, AIS and NAIS patients is also provided in Figure 12.
Table 9. Biomarkers Comparison of non-AIS scoliotic Patients.
Type of Scoliosis Characteristics
Number Mean Age Mean Cobb Mean OPN Mean sCD44 Mean HA (Years) Angle Concentration Concentration Concentration (ng/ml) (ng/ml) (ng/ml)
Neurological 8 12.3 ± 3.7 79.4 ± 15.1 982 ± 452 274 ± 196 127 ± 101 Scoliosis
Congenital Scoliosis 8 10.0 ± 4.4 51.8 ± 18.1 1016 ± 400 432 ± 79 123 ± 80
Spondylolisthesis 5 17.5 ± 2.1 21.0 ± 17.0 832 ± 125 386 ± 193 76 ± 54
Kyphosis Scoliosis 5 14.4 ± 2.8 80.2 ± 28.5 923 ± 393 352 ± 62 91 ± 56
Other * 2 15.1 74.5 ± 17.7 586 ± 52 240 NA t Plus-minus values are means ± standard deviations
* Other scoliosis types include one neuromuscular scoliosis and one dysplasic scoliosis.
[00159] Table 10 below presents in detail biomarkers levels for non AIS scoliotic patients.
Table 10. Clinical and biochemical profiles of non AIS scoliotic patients.
Cobb's
Patient Collection Angle Curve Date of Age at Family [SCD44] [HA] ID Date of Birth Gender Age Date Diagnosis Pre-op Type Surgery Surgery History [OPN] (ng/ml) (ng/ml) (ng/ml)
2004-11- 1101.06 ± 82.89 ±
1208 1990-01-19 M 17.8 2007-10-03 Congenital cyphose scoliosis 72 IT 08 14.8 — 31.26 444.81 15.11
2005-03- 127.74 ±
1256 1992-03-27 M 13.0 2005-05-09 Congenital scoliosis 44-65 rTIL 29 13.0 — 1490.59 NA 9.29
Congenital neurological 2005-05-
1278 1998-07-22 F 6.8 2005-05-30 scoliosis 60 IT 30 6.8 — 1401.88 NA 75.65 ± 5.16
2005-06- 150.30 ±
1281 1985-05-21 M 20.1 2005-06-01 Spondylolisthesis 16 _ 01 20.1 — 985.85 NA 7.93
2005-06-
1286 1990-05-08 M 15.1 2005-06-15 Dysplasic scoliosis 62-66 rTIL 15 15.1 — 549.60 ± 5.06 NA NA
2006-04- 111.51 ±
1356 1993-02-22 F 13.2 2006-04-03 Congenital scoliosis 75 rT 03 13.2 — 1181.85 NA 2.30
2006-04- 284.60 ±
1358 2003-11-09 M 2.4 2006-04-04 Congenital scoliosis 33-35 rTIL 04 2.4 — 1530.6 NA 69.00
2006-05- 350.01 ±
1367 1993-12-12 F 12.4 2006-02-01 Neurological scoliosis 90 ITL 01 12.4 — 1525.13 NA 36.55
2006-05- 126.44 ±
1368 1990-06-21 F 15.9 2006-05-02 Neurological cyphosis 50 ITL 02 15.9 — 1079.23 NA 3.63 o
2006-05- 104.06 ±
1370 1995-09-15 M 10.7 2006-05-09 Neurological scoliosis 65 rT 09 10.7 — 1318.58 NA 5.18
2006-05-
1375 1992-09-13 F 13.7 2006-05-30 Congenital scoliosis 53 rTL 30 13.7 Cousin 380.08 ± 12.95 NA NA
2006-09- 116.09 ±
1407 1990-12-22 M 16.8 2007-10-31 Spondylolisthesis 9 IL 25 15.8 — 818.17 ± 1.52 441.73 3.88
2007-01- 450.78 ± 130.30 ±
1431 1987-11-23 M 19.2 2007-01-08 Neurological scoliosis 90-90 rTIT 08 19.2 — 101.56 275.62 23.92
2007-01- 98.99 ±
1432 1992-08-08 M 14.4 2007-01-09 Neurological scoliosis 64 rT 09 14.4 — 558.47 ± 4.70 145.15 13.92
2007-01-
1434 1994-08-07 F 12.4 2007-01-10 Congenital scoliosis 79-77 rTIL 10 12.4 — 631.59 ± 7.42 325.95 44.79 ± 5.73
2007-01-
1436 1993-02-16 F 13.9 2007-01-22 Cyphose scoliosis 120 _ 22 13.9 — 220.32± 2.94 322.03 44.34 ± 6.37
2007-02-
1437 1992-11-06 M 14.2 2007-02-05 Neurological scoliosis 100 NA 05 14.2 — 388.01 ± 8.22 225.71 76.96 ± 4.53
2007-04-
1455 1996-12-14 F 10.3 2007-04-03 Congenital cyphose scoliosis 61 ITL 03 10.3 — 1090.51 ± 5.57 323.24 34.79 ± 0.32
2007-04-
1456 1990-10-03 F 16.5 2007-04-17 Neuromuscular scoliosis 87 rTL 17 16.5 — 622.46 ± 7.15 240.22 NA
2007-04-
1462 1997-10-22 F 9.5 2007-04-23 Neurological scoliosis 76 ITL 23 9.5 — 1118.25 ± 1.32 607.1 55.90 ± 1.82
1463 1989-03-19 F 18.1 2007-04-24 Scoliosis+Spondylolisthesis 33 rT 2007-04- 18.1 — 751.54 ± 8.69 284.71 21.56 ± 4.58
24
2007-05-
1466 1997-08-24 F 9.8 2007-05-08 Congenital scoliosis 39 rt 08 9.8 — 1110.01 ± 2.38 510.18 47.07 ± 1.48
2007-06- 166.63 ±
1475 1993-05-25 M 14.1 2007-06-05 Cyphose scoliosis 98 _ 04 14.1 — 1123.49 ± 5.56 319.93 34.63
2007-06- 1098.54 ±
1479 1996-01-24 F 11.4 2007-06-05 Neurological scoliosis 90 rTIL 05 11.4 — 131.44 119.17 NA
2007-06- 120.72 ±
1480 2003-06-13 F 4.0 2007-06-18 Congenital scoliosis 56 IT 18 4.0 — 809.8 468.03 40.73
2007-06-
1482 1989-03-30 F 18.2 2007-06-19 Spondylolisthesis gr 1 _ NA 19 18.2 — 678.49 ± 18.32 187.48 46.07 ± 5.27
2007-06-
1486 1993-01-15 M 14.4 2007-06-27 Spondylolisthesis gr 2 _ NA 27 14.4 — 924.40 ± 17.16 628.78 47.06 ± 6.84
127.33 ±
357 1996-07-08 F 11.4 2007-12-18 Congenital scoliosis 30-31 rTIT — 996.58 ± 8.51 423.72 3.13
* Plus-minus values are means ± standard deviations. t Curve type nomenclature: r, right/ 1, left/ T, Thoracic/ L, Lumbar/ TL, Thoracolumbar/ C, Cervical
c\
EXAMPLE 12
OPN and sCD44 levels in AIS patients pre and post operations [00160] OPN levels were measured in AIS patients pre (n=79) and post
(N=28) operations. Interestingly, comparison of AIS patients in pre-operation vs. post operation showed a reduction in circulating OPN levels, which further support the role of OPN at the cellular level as mechanosensor (Figure 13).
[00161] OPN were measured in AIS female patients pre (n=10) and post (N=10) treatment with braces. Similarly, sCD44 levels were measured in AIS female patients pre (n=15) and post (N=12) operations. Results are presented in Figure 14.
[00162] A distribution of 12 AIS patients was also performed across the predefined cut-off zones pre-operation and post-operation. Figure 15 shows 92% of the surgically treated patients had pre-operation OPN levels in the red-zone (>800ng/mL of plasma OPN level), while the remaining 8% were in the yellow zone (700-800ng/mL). No patients were in the green zone representing plasma OPN levels <700 ng/mL. This also shows a strong correlation between high OPN concentrations and the progression of scoliotic curves.
[00163] Panel B of Figure 15 show that red zone patients who were treated surgically experienced a decline in OPN concentrations in the blood. 75% of the surgically treated patients fell into the green and yellow zones (800 ng/mL or less).
EXAMPLE 13
OPN levels in AIS patients with various types of braces
[00164] OPN levels were also measured in AIS patients prior to being treated with brace (n=79) and after brace (N=28). Table 11 below also shows the effect of braces on biomarkers.
Table 11. Possible effects of brace treatment on biomarker concentrations.
Treatment Characteristics
No. Mean Mean Mean Mean OPN Mean sCD44 Mean HA
Age Brace Cobb's Concentration Concentration Concentration
(Years) Wear Angle (ng/ml) (ng/ml) (ng/ml)
(Months)
Without Brace
Female 193 14.2 ± - 30.9 ± 809 ± 376 474 ± 179 108 ± 58 2.1 19.3
Male 36 14.8 ± - 32.2 ± 1034 ± 492 ± 155 126 ± 62 2.2 21.1 376
With Brace (All Female)
All Braces Combined
21 14.0 ± 12.0 21.2 ± 664 ± 282 483 ± 112 118 ± 60 1.8 8.3
Boston
5 13.0 ± 10.6 25.8 ± 735 ± 358 568 ± 184 150 ± 57 1.4 4.4
SpineCor
14 14.5 ± 12.7 20.6 ± 626 ± 279 451 ± 81 108 ± 62 1.6 8.7
Charleston
1 15.4 10.0 7.0 781 532 70
Providence Night Brace
1 9.7 1.0 20.0 732 547 138
P -value t 0.018 0.879 0.608
' Plus-minus values are means ± standard deviations. t Statistical analysis to compare patients with or without brace was done by bilateral unpaired Student's T-test with equal variance. A difference was considered statistically significant with a p-value < 0.05.
[00165] A distribution of AIS patients across the predefined cut-off zones was also performed prior to being treated with bracing and after bracing. Eight patients were tested a certain number of months after bracing, namely for each of patients #1 to 8: 7, 7, 8, 22, 22, 22 and 26 months after bracing, respectively. Figure 16 shows that prior to being treated with bracing (Panel A), 63% of these patients were in the red and yellow zones. A significant shift towards the green zone (<700ng/mL) was observed, which is consistent with the trend observed in surgically treated patients, as presented in Figures 13 -15.
EXAMPLE 14 Comparison of selenium levels in AIS patients vs. healthy subjects
[00166] Selenium concentration was reported to be significantly decreased in plasma of AIS patients (42). Selenium and more specifically Se-methylselenocystein, an
organoselenium naturally occurring in diet, are used to prevent metastasis in breast cancer as chemopreventive therapy by targeting OPN transcription (43-45).
[00167] Plasma selenium concentration was thus measured in pediatric populations (AIS vs. healthy controls) to determine whether or not low selenium levels correlate with higher OPN concentrations in AIS. Plasma selenium concentrations were determined by a fluorometric method using 2,3-diaminonaphthalene (DAN) (46, 47). Results presented in Figures 18 and 19 show a correlation between high OPN levels and low selenium levels in scoliotic and asymptomatic at risk children.
[00168] Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.
REFERENCES
(1) Brodner W1 Krepler P, Nicolakis M et al. Melatonin and adolescent idiopathic scoliosis. J Bone Joint Surg Br 2000; 82(3):399-403.
(2) Lowe TG1 Edgar M, Margulies JY et al. Etiology of idiopathic scoliosis: current trends in research. J Bone Joint Surg Am 2000; 82-A(8):1157-1168.
(3) Veldhuizen AG1 Wever DJ1 Webb PJ. The aetiology of idiopathic scoliosis: biomechanical and neuromuscular factors. Eur Spine J 2000; 9(3):178-184.
(4) Miller NH. Cause and natural history of adolescent idiopathic scoliosis. Orthop Clin North Am 1999; 30(3):343-52, vii.
(5) Miller NH. Genetics of familial idiopathic scoliosis. Clin Orthop 2002;(401 ):60-64.
(6) Miller NH, Schwab DL, Sponseller PD, Manolio TA, Pugh EW, Wilson AP. Characterization of idiopathic scoliosis in a clinically well-defined population. Clin Orthop 2001 ;(392):349-357.
(7) Wise CA1 Barnes R, Gillum J1 Herring JA1 Bowcock AM1 Lovett M. Localization of susceptibility to familial idiopathic scoliosis. Spine 2000; 25(18):2372-2380.
(8) Moreau A, Wang DS, Forget S et al. Melatonin Signaling Dysfunction in Adolescent Idiopathic Scoliosis. Spine 2004.
(9) Denhardt DT, Noda M, O'Regan AW, Pavlin D, Berman JS. Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. J Clin Invest 2001 ; 107(9):1055-1061.
(10) Mazzali M, Kipari T, Ophascharoensuk V, Wesson JA, Johnson R, Hughes J. Osteopontin-a molecule for all seasons. QJM 2002; 95(1):3-13.
(11) Lopez CA, Olson ES, Adams JC, Mou K, Denhardt DT, Davis RL. Osteopontin expression detected in adult cochleae and inner ear fluids. Hear Res 1995; 85(1- 2):210-222.
(12) Simoneau M, Richer N, Mercier P1 Allard P, Teasdale N. Sensory deprivation and balance control in idiopathic scoliosis adolescent. Exp Brain Res 2006; 170(4):576-582.
(13) Guo X1 Chau WW, Hui-Chan CW, Cheung CS, Tsang WW1 Cheng JC. Balance control in adolescents with idiopathic scoliosis and disturbed somatosensory function. Spine 2006; 31(14):E437-E440.
(14) Weber B1 Rosel M1 Arch R1 Moller P, Zoller M. Transient expression of CD44 variant isoforms in the ontogeny of the rat: ectoderm-, endoderm- and mesoderm-derived cells express different exon combinations. Differentiation 1996; 60(1 ):17-29.
(15) Panda D, Kundu GC, Lee BI et al. Potential roles of osteopontin and alphaVbeta3 integrin in the development of coronary artery restenosis after angioplasty. Proc Natl Acad Sci U S A 1997; 94(17):9308-9313.
(16) Ruiz P, Schwarzler C, Gunthert U. CD44 isoforms during differentiation and development. Bioessays 1995; 17(1): 17-24.
(17) Katagiri YU, Sleeman J, Fujii H et al. CD44 variants but not CD44s cooperate with betai -containing integrins to permit cells to bind to osteopontin independently of arginine-glycine-aspartic acid, thereby stimulating cell motility
and chemotaxis. Cancer Res 1999; 59(1 ):219-226.
(18) Jalkanen S, Jalkanen M. Lymphocyte CD44 binds the COOH-terminal heparin- binding domain of fibronectin. J Cell Biol 1992; 116(3):817-825.
(19) Naujokas MF, Morin M, Anderson MS, Peterson M, Miller J. The chondroitin sulfate form of invariant chain can enhance stimulation of T cell responses through interaction with CD44. Cell 1993; 74(2):257-268.
(20) Weber GF, Ashkar S, Glimcher MJ, Cantor H. Receptor-ligand interaction between CD44 and osteopontin (Eta-1). Science 1996; 271(5248):509-512.
(21) Bennett KL, Modrell B, Greenfield B et al. Regulation of CD44 binding to hyaluronan by glycosylation of variably spliced exons. J Cell Biol 1995; 131(6 Pt 1):1623-1633.
(22) Stamenkovic I, Aruffo A, Amiot M, Seed B. The hematopoietic and epithelial forms of CD44 are distinct polypeptides with different adhesion potentials for hyaluronate-bearing cells. EMBO J 1991 ; 10(2):343-348.
(23) Komura K, Sato S, Fujimoto M, Hasegawa M, Takehara K. Elevated levels of circulating CD44 in patients with systemic sclerosis: association with a milder subset. Rheumatology (Oxford) 2002; 41 (10): 1149-1154.
(24) Scott DA, Stapleton JA, Palmer RM et al. Plasma concentrations of reputed tumor-associated soluble CD44 isoforms (v5 and v6) in smokers are dose related and decline on smoking cessation. Cancer Epidemiol Biomarkers Prev 2000; 9(11 ):1211-1214.
(25) Wang X, Jiang H, Raso J et al. Characterization of the scoliosis that develops after pinealectomy in the chicken and comparison with adolescent idiopathic scoliosis in humans. Spine 1997; 22(22):2626-2635.
(26) von Gall C, Lewy A, Schomerus C et al. Transcription factor dynamics and neuroendocrine signalling in the mouse pineal gland: a comparative analysis of melatonin-deficient C57BL mice and melatonin-proficient C3H mice. Eur J Neurosci 2000; 12(3):964-972.
(27) Aherrahrou Z, Axtner SB, Kaczmarek PM et al. A locus on chromosome 7 determines dramatic up-regulation of osteopontin in dystrophic cardiac calcification in mice. Am J Pathol 2004; 164(4):1379-1387.
(28) Machida M, Dubousset J, Yamada T et al. Experimental scoliosis in melatonin- deficient C57BL/6J mice without pinealectomy. J Pineal Res 2006; 41(1):1-7.
(29) Scoliosis Research Society. Morbidity & Mortality Committee annual report 1997.
(30) Mishima R, Takeshima F, Sawai T et al. High plasma osteopontin levels in patients with inflammatory bowel disease. J Clin Gastroenterol 2007; 41 (2): 167- 172.
(31) Ang C, Chambers AF, Tuck AB, Winquist E, Izawa Jl. Plasma osteopontin levels are predictive of disease stage in patients with transitional cell carcinoma of the bladder. BJU lnt 2005; 96(6):803-805.
(32) Wong CK, Lit LC1 Tarn LS, Li EK, Lam CW. Elevation of plasma osteopontin concentration is correlated with disease activity in patients with systemic lupus erythematosus. Rheumatology (Oxford) 2005; 44(5):602-606.
(33) Kim J, Ki SS, Lee SD et al. Elevated plasma osteopontin levels in patients with
hepatocellular carcinoma. Am J Gastroenterol 2006; 101(9):2051-2059.
(34) Wynne-Davies R. Familial (idiopathic) scoliosis. A family survey. J Bone Joint Surg Br 1968; 50(1 ):24-30.
(35) De George FV, Fisher RL. Idiopathic scoliosis: genetic and environmental aspects. J Med Genet 1967; 4(4):251-257.
(36) Lein M, Jung K, Weiss S, Schnorr D, Loening SA. Soluble CD44 variants in the serum of patients with urological malignancies. Oncology 1997; 54(3):226-230.
(37) Karjalainen JM, Tammi RH, Tammi Ml et al. Reduced level of CD44 and hyaluronan associated with unfavorable prognosis in clinical stage I cutaneous melanoma. Am J Pathol 2000; 157(3):957-965.
(38) Schlosser W, Gansauge F, Schlosser S, Gansauge S, Beger HG. Low serum levels of CD44, CD44v6, and neopterin indicate immune dysfunction in chronic pancreatitis. Pancreas 2001 ; 23(4):335-340.
(39) Sjoberg S, Fogelstrand L, Hulthe J, Fagerberg B, Krettek A. Circulating soluble CD44 is higher among women than men and is not associated with cardiovascular risk factors or subclinical atherosclerosis. Metabolism 2005; 54(2):139-141.
(40) Jenkins RH, Thomas GJ, Williams JD, Steadman R. Myofibroblastic differentiation leads to hyaluronan accumulation through reduced hyaluronan turnover. J Biol Chem 2004; 279(40):41453-41460.
(41) Lien YH, Fu J, Rucker RB, Scheck M, Abbott U, Stern R. Collagen, proteoglycan and hyaluronidase activity in cultures from normal and scoliotic chicken fibroblasts. Biochim Biophys Acta 1990; 1034(3):318-325.
(42) Dastych M, Cienciala J. Idiopathic scoliosis and concentrations of zinc, copper, and selenium in blood plasma. Biol Trace Elem Res 2002; 89(2): 105-110.
(43) El-Bayoumy K, Sinha R. Molecular chemoprevention by selenium: a genomic approach. Mutat Res 2005; 591(1-2):224-236.
(44) Unni E, Kittrell FS, Singh U, Sinha R. Osteopontin is a potential target gene in mouse mammary cancer chemoprevention by Se-methylselenocysteine. Breast Cancer Res 2004; 6(5):R586-R592.
(45) He YT, Liu DW, Ding LY, Li Q, Xiao YH. Therapeutic effects and molecular mechanisms of anti-fibrosis herbs and selenium on rats with hepatic fibrosis. World J Gastroenterol 2004; 10(5)703-706.
(46) Sheehan TM, Gao M. Simplified fluorometric assay of total selenium in plasma and urine. Clin Chem 1990; 36(12):2124-2126.
(47) Ando M, Takizawa M, Suwabe S, Yamato S, Shimada K. Determination of selenium in human serum by liquid chromatography/electron capture atmospheric pressure chemical ionization mass spectrometry after acid digestion and derivatization using 2,3-diaminonaphthalene. Eur J Mass Spectrom (Chichester, Eng) 2003; 9(6):619-622.
(48) Uchio E, Matsuura N, Kadonosono K, Ohno S, Uede T. Tear osteopontin levels in patients with allergic conjunctival diseases. Graefes Arch Clin Exp Ophthalmol, 2002; 240(11): 924-8.
(49) Buck et al. Design Strategies and Performance of Custom DNA Sequencing
primers . Biotechniques 1999; 27:528-536.
(50) Ponta, H, Sherman L, Herrlich, PA. CD44 : from Adhesion molecules to signalling regulators. Nature Reviews. 2004; 4:33-45.
(51 ) Garrett, KA1 P. D. Esker, and A.H. Sparks. 2007. Introduction to the R Programming Environment. The Plant Health Instructor. DOI:10.1094/PHI-A- 2007-1226-02.
(52) lhaka R, Gentleman R. A language for data analysis and graphics. Journal of Computational and Graphical Statisticsi 996, 5(3):299-314.
(53) Goodison S, and Tarin D. Clinical Implications Of Anomalous Cd44 Gene Expression In Neoplasia. Frontiers in Bioscience 1998, 3, e89-109.
(54) lto T, Hashimoto Y, Tanaka E, Kan T, Tsunoda S, Sato F, Higashiyama M, Okumura T, Shimada Y. An Inducible Short-Hairpin RNAVector against Osteopontin Reduces Metastatic Potential of Human Esophageal Squamous Cell Carcinoma In vitro and In vivo Clin Cancer Res 2006; 12(4) 1308-1316.
(55) Kadkol SS, Lin AY, Barak V, Kalickman I1 Leach L, Valyi-Nagy K, Majumdar D, Setty S, Maniotis A J, Folberg R, Pe'er J. Osteopontin Expression and Serum Levels in Metastatic Uveal Melanoma — A Pilot Study Invest Ophthalmol Vis Sci. 2006; 47(3): 802-806.
(56) Guarino V, Faviana P, Salvatore G, Castellone MD, Cirafici A , De Falco V, Celetti A, Giannini R, Basolo F, MeIiIIo RM1 Santoro M. Osteopontin Is Overexpressed in Human Papillary Thyroid Carcinomas and Enhances Thyroid Carcinoma Cell Invasiveness. The Journal of Clinical Endocrinology & Metabolism .200590(9):5270-5278.
(57) Ponta et al, Nat Rev MoI Cell Biol. 2003 Jan;4(1 ):33-45. Review.