Back To List
Search result: 1 of 1

(WO/2008/154333) MIR-34 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION

(WO/2008/154333) MIR-34 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION

WO 2008154333 20081218

DECRIPTION

mJR-34 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION

[0001] This application claims priority to United States Provisional Application serial number 60/942,971 filed June 8, 2007, which is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

I. FIELD OF THE INVENTION

[0002] The present invention relates to the fields of molecular biology and medicine. More specifically, the invention relates to methods and compositions for the treatment of diseases or conditions that are affected by miR-34 microRNAs, microRNA expression, and genes and cellular pathways directly and indirectly modulated by such.

II. BACKGROUND

[0003] In 2001, several groups used a cloning method to isolate and identify a large group of "microRNAs" (miRNAs) from C. elegans, Drosophila, and humans (Lagos-Quintana et ah, 2001; Lau et ah, 2001; Lee and Ambros, 2001). Several hundreds of miRNAs have been identified in plants and animals — including humans — which do not appear to have endogenous siRNAs. Thus, while similar to siRNAs, miRNAs are distinct.

[0004] miRNAs thus far observed have been approximately 21-22 nucleotides in length, and they arise from longer precursors, which are transcribed from non-protein- encoding genes. See review of Carrington and Ambros (2003). The precursors form structures that fold back on themselves in self-complementary regions; they are then processed by the nuclease Dicer (in animals) or DCLl (in plants) to generate the short double-stranded miRNA. One of the miRNA strands is incorporated into a complex of proteins and miRNA called the RNA-induced silencing complex. The miRNA guides the RISC complex to a target mRNA, which is then cleaved or translationally silenced, depending on the degree of sequence complementarity of the miRNA to its

target mRNA. Currently, it is believed that perfect or nearly perfect complementarity leads to mRNA degradation, as is most commonly observed in plants. In contrast, imperfect base pairing, as is primarily found in animals, leads to translational silencing. However, recent data suggest additional complexity (Bagga et al, 2005; Lim et al, 2005), and mechanisms of gene silencing by miRNAs remain under intense study.

[0005] Recent studies have shown that changes in the expression levels of numerous miRNAs are associated with various cancers (reviewed in Esquela- Kerscher and Slack, 2006; Calin and Croce, 2006). miRNAs have also been implicated in regulating cell growth and cell and tissue differentiation - cellular processes that are associated with the development of cancer.

[0006] The inventors previously demonstrated that hsa-miR-34 is involved with the regulation of numerous cell activities that represent intervention points for cancer therapy and for therapy of other diseases and disorders (U.S. Patent Applications serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed November 14, 2005, each of which is incorporated herein by reference in its entirety). In a survey of 24 different human tissues, the inventors observed that miR-34 is preferentially or exclusively expressed in human lymph node tissues. When transformed into various cancer cell lines from humans, miR-34a inhibits the proliferation of prostate cancer cells (22RvI), lung cancer cells (A549), basal cell carcinoma cells (TE354T), cervical cancer cells (HeLa), and leukemic T cells (Jurkat), but miR-34a had no anti-proliferative effect on normal human T cells. Upon transformation, miR-34a increased (Jurkat) or decreased (HeLa) programmed cell death (apoptosis) in cells. Uncontrolled cell proliferation is a hallmark of cancer. Apoptosis is a natural cellular process that helps control cancer by inducing death in cells with oncogenic potential. Many oncogenes function by altering induction of apoptosis. More recently, others have observed miR-34a to be over-expressed in cancerous liver cells (Meng et al, 2006).

[0007] Bioinformatics analyses suggest that any given miRNA may bind to and alter the expression of up to several hundred different genes. In addition, a single gene may be regulated by several miRNAs. Thus, each miRNA may regulate a complex interaction among genes, gene pathways, and gene networks. Mis-regulation

or alteration of these regulatory pathways and networks, involving miRNAs, are likely to contribute to the development of disorders and diseases such as cancer. Although bioinformatics tools are helpful in predicting miRNA binding targets, all have limitations. Because of the imperfect complementarity with their target binding sites, it is difficult to accurately predict the mRNA targets of miRNAs with bioinformatics tools alone. Furthermore, the complicated interactive regulatory networks among miRNAs and target genes make it difficult to accurately predict which genes will actually be mis-regulated in response to a given miRNA.

[0008] Correcting gene expression errors by manipulating miRNA expression or by repairing miRNA mis-regulation represent promising methods to repair genetic disorders and cure diseases like cancer. A current, disabling limitation of this approach is that, as mentioned above, the details of the regulatory pathways and networks that are affected by any given miRNA, including miR-34, remain largely unknown. This represents a significant limitation for treatment of cancers in which miR-34 may play a role. A need exists to identify the genes, genetic pathways, and genetic networks that are regulated by or that may regulate hsa-miR-34 expression.

SUMMARY OF THE INVENTION

[0009] The present invention provides additional compositions and methods by identifying genes that are direct targets for miR-34 regulation or that are indirect or downstream targets of regulation following the miR-34 -mediated modification of another gene(s) expression. Furthermore, the invention describes gene, disease, and/or physiologic pathways and networks that are influenced by miR-34 and its family members. In certain aspects, compositions of the invention are administered to a subject having, suspected of having, or at risk of developing a metabolic, an immunologic, an infectious, a cardiovascular, a digestive, an endocrine, an ocular, a genitourinary, a blood, a musculoskeletal, a nervous system, a congenital, a respiratory, a skin, or a cancerous disease or condition.

[0010] In particular aspects, a subject or patient may be selected for treatment based on expression and/or aberrant expression of one or more miRNA or mRNA. In a further aspect, a subject or patient may be selected for treatment based on aberrations in one or more biologic or physiologic pathway(s), including aberrant expression of one or more gene associated with a pathway, or the aberrant expression

of one or more protein encoded by one or more gene associated with a pathway. In still a further aspect, a subject or patient may be selected based on aberrations in miRNA expression, or biologic and/or physiologic pathway(s). A subject may be assessed for sensitivity, resistance, and/or efficacy of a therapy or treatment regime based on the evaluation and/or analysis of miRNA or mRNA expression or lack thereof. A subject may be evaluated for amenability to certain therapy prior to, during, or after administration of one or therapy to a subject or patient. Typically, evaluation or assessment may be done by analysis of miRNA and/or mRNA, as well as combination of other assessment methods that include but are not limited to histology, immunohistochemistry, blood work, etc.

[0011] In some embodiments, an infectious disease or condition includes a bacterial, viral, parasite, or fungal infection. Many of these genes and pathways are associated with various cancers and other diseases. Cancerous conditions include, but are not limited to astrocytoma, anaplastic large cell lymphoma, acute lymphoblastic leukemia, acute myeloid leukemia, angiosarcoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma, carcinoma of the head and neck, chronic lymphocytic leukemia, chronic myeloid leukemia, colorectal carcinoma, endometrial carcinoma, glioma, glioblastoma, gastric carcinoma, gastrinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, Kaposi's sarcoma, leukemia, lung carcinoma, leiomyosarcoma, laryngeal squamous cell carcinoma, melanoma, mucosa-associated lymphoid tissue B-cell lymphoma, medulloblastoma, mantle cell lymphoma, meningioma, myeloid leukemia, multiple myeloma, high-risk myelodysplastic syndrome, mesothelioma, neurofibroma, non-Hodgkin lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, oropharyngeal carcinoma, osteosarcoma, pancreatic carcinoma, papillary carcinoma, prostate carcinoma, pheochromocytoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, schwannoma, small cell lung cancer, salivary gland tumor, sporadic papillary renal carcinoma, thyroid carcinoma, testicular tumor, urothelial carcinoma wherein the modulation of one or more gene is sufficient for a therapeutic response. Typically a cancerous condition is an aberrant hyperproliferative condition associated with the uncontrolled growth or inability to undergo cell death, including apoptosis.

[0012] The present invention provides methods and compositions for identifying genes that are direct targets for miR-34 regulation or that are downstream targets of regulation following the miR-34-mediated modification of upstream gene expression. Furthermore, the invention describes gene pathways and networks that are influenced by miR-34 expression in biological samples. Many of these genes and pathways are associated with various cancers and other diseases. The altered expression or function of miR-34 in cells would lead to changes in the expression of these key genes and contribute to the development of disease or other conditions. Introducing miR-34 (for diseases where the miRNA is down-regulated) or a miR-34 inhibitor (for diseases where the miRNA is up-regulated) into disease cells or tissues or subjects would result in a therapeutic response. The identities of key genes that are regulated directly or indirectly by miR-34 and the disease with which they are associated are provided herein. In certain aspects a cell may be an endothelial, a mesothelial, an epithelial, a stromal, or a mucosal cell. In certain aspects the cell is a glial, a leukemic, a colorectal, an endometrial, a fat, a meninges, a lymphoid, a connective tissue, a retinal, a cervical, a uterine, a brain, a neuronal, a blood, a cervical, an esophageal, a lung, a cardiovascular, a liver, a breast, a bone, a thyroid, a glandular, an adrenal, a pancreatic, a stomach, a intestinal, a kidney, a bladder, a prostate, a uterus, an ovarian, a testicular, a splenic, a skin, a smooth muscle, a cardiac muscle, or a striated muscle cell. In certain aspects, the cell, tissue, or target may not be defective in miRNA expression yet may still respond therapeutically to expression or over expression of a miRNA. miR-34 could be used as a therapeutic target for any of these diseases. In certain embodiments miR-34 can be used to modulate the activity of miR-34 in a subject, organ, tissue, or cell.

[0013] A cell, tissue, or subject may be a cancer cell, a cancerous tissue, harbor cancerous tissue, or be a subject or patient diagnosed or at risk of developing a disease or condition. In certain aspects a cancer cell is a neuronal, glial, lung, liver, brain, breast, bladder, blood, leukemic, colon, colorectal, endometrial, stomach, skin, ovarian, fat, bone, cervical, esophageal, pancreatic, prostate, kidney, epithelial, intestinal, lymphoid, muscle, adrenal, salivary gland, testicular, or thyroid cell. In still a further aspect cancer includes, but is not limited to astrocytoma, anaplastic large cell lymphoma, acute lymphoblastic leukemia, acute myeloid leukemia, angiosarcoma, breast carcinoma, B-cell lymphoma, bladder carcinoma, cervical carcinoma,

carcinoma of the head and neck, chronic lymphocytic leukemia, chronic myeloid leukemia, colorectal carcinoma, endometrial carcinoma, glioma, glioblastoma, gastric carcinoma, gastrinoma, hepatoblastoma, hepatocellular carcinoma, Hodgkin lymphoma, Kaposi's sarcoma, leukemia, lung carcinoma, leiomyosarcoma, laryngeal squamous cell carcinoma, melanoma, mucosa-associated lymphoid tissue B-cell lymphoma, medulloblastoma, mantle cell lymphoma, meningioma, myeloid leukemia, multiple myeloma, high-risk myelodysplastic syndrome, mesothelioma, neurofibroma, non-Hodgkin lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, oropharyngeal carcinoma, osteosarcoma, pancreatic carcinoma, papillary carcinoma, prostate carcinoma, pheochromocytoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, schwannoma, small cell lung cancer, salivary gland tumor, sporadic papillary renal carcinoma, thyroid carcinoma, testicular tumor, urothelial carcinoma. In certain aspects the cancerous condition is lung carcinoma. In a further aspect the lung carcinoma is a non-small cell carcinoma. In yet a further aspect the non-small cell carcinoma is an adenocarcinoma, a squamous cell carcinoma, a large cell carcinoma, an adenosquamous cell carcinoma, or a bronchioalveolar carcinoma. In certain aspects the cancerous condition is prostate carcinoma. In a further aspect the prostate carcinoma can be PSA positive or negative and/or androgen dependent or independent.

[0014] Embodiments of the invention include methods of modulating gene expression, or biologic or physiologic pathways in a cell, a tissue, or a subject comprising administering to the cell, tissue, or subject an amount of an isolated nucleic acid or mimetic thereof comprising a miR-34 nucleic acid, mimetic, or inhibitor sequence in an amount sufficient to modulate the expression of a gene positively or negatively modulated by a miR-34 miRNA. A "miR-34 nucleic acid sequence" or "miR-34 inhibitor" includes the full length precursor of miR-34, or complement thereof or processed (i.e., mature) sequence of miR-34 and related sequences set forth herein, as well as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of a precursor miRNA or its processed sequence, or complement thereof, including all ranges and integers there between. In certain embodiments, the miR-34 nucleic acid sequence or miR-34 inhibitor contains the full-length processed miRNA sequence or complement thereof

and is referred to as the "miR-34 full-length processed nucleic acid sequence" or "miR-34 full-length processed inhibitor sequence." In still further aspects, the miR- 34 nucleic acid comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide (including all ranges and integers there between) segment or complementary segment of a miR-34 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NO:1 to SEQ ID NO:73. The general term miR-34 includes all members of the miR-34 family that share at least part of a mature miR-34 sequence. Mature miR-34 sequences include hsa-miR-34a

UGGCAGUGUCUUAGCUGGUUGUU (MIMAT0000255; SEQ ID NO:1); hsa- miR-34b UAGGC AGUGUC AUUAGCUGAUUG (MIMAT0000685; SEQ ID NO:2); hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC (MIMAT0000686; SEQ ID NO:3); cbr-miR-34 AGGCAGUGUGGUUAGCUGGUUG (MIMAT0000466; SEQ ID NO:4); rno-miR-34b UAGGC AGUGUAAUUAGCUGAUUG (MIMAT0000813; SEQ ID NO:5); dps-miR-34 UGGCAGUGUGGUUAGCUGGUUG (MIMATOOO 1223; SEQ ID NO:6); cel-miR-34

AGGCAGUGUGGUUAGCUGGUUG (MIMAT0000005; SEQ ID NO:7); mml-miR- 34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002499; SEQ ID NO: 8); mmu- miR-34b UAGGC AGUGUAAUUAGCUGAUUG (MIMAT0000382; SEQ ID NO:9); sla-miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002500; SEQ ID NO: 10); ppy-miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002497; SEQ ID NO: 11); bta-miR-34c AGGCAGUGUAGUUAGCUGAUUG (MIMAT0003854; SEQ ID NO: 12); dre-miR-34c

AGGCAGUGCAGUUAGUUGAUUAC (MIMAT0003759; SEQ ID NO: 13); mmu- miR-34a UGGCAGUGUCUUAGCUGGUUGUU (MIMAT0000542; SEQ ID NO: 14); rno-miR-34a UGGCAGUGUCUUAGCUGGUUGUU (MIMAT0000815; SEQ ID NO: 15); bta-miR-34b AGGC AGUGUAAUUAGCUGAUUG (MIMAT0003549; SEQ ID NO: 16); dme-miR-34

UGGCAGUGUGGUUAGCUGGUUG (MIMAT0000350; SEQ ID NO: 17); ggo- miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002494; SEQ ID NO: 18); mdo-miR-34a UGGCAGUGUCUUAGCUGGUUGUU (MIMAT0004096; SEQ ID NO: 19); gga-miR-34a UGGCAGUGUCUUAGCUGGUUGUU (MIMATOOO 1173; SEQ ID NO:20); age-miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002495; SEQ ID NO:21); gga-miR-34b

CAGGCAGUGUAGUUAGCUGAUUG (MIMATOOOl 179; SEQ ID NO:22); Ua-

miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002501; SEQ ID NO:23); gga-miR-34c AGGCAGUGUAGUUAGCUGAUUGC (MIMATOOOl 180; SEQ ID NO:24); xtr-miR-34b CAGGCAGUGUAGUUAGCUGAUUG (MIMAT0003579; SEQ ID NO:25); ppa-miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002496; SEQ ID NO:26); mmu-miR-34c

AGGCAGUGUAGUUAGCUGAUUGC (MIMAT0000381; SEQ ID NO:27); dre- miR-34 UGGCAGUGUCUUAGCUGGUUGU (MIMATOOO 1269; SEQ ID NO:28); xtr-miR-34a UGGCAGUGUCUUAGCUGGUUGUU (MIMAT0003578; SEQ ID NO:29); bmo-miR-34 UGGCAGUGUGGUUAGCUGGUUG (MIMAT0004197; SEQ ID NO:30); dre-miR-34b UAGGCAGUGUUGUUAGCUGAUUG (MIMAT0003346; SEQ ID NO:31); rno-miR-34c

AGGCAGUGUAGUUAGCUGAUUGC (MIMAT0000814; SEQ ID NO:32); mne- miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002502; SEQ ID NO:33); ptr-miR-34a UGGCAGUGUCUUAGCUGGUUGU (MIMAT0002498; SEQ ID NO:34) or a complement thereof. In certain aspects, a subset of these miRNAs will be used that include some but not all of the listed miR-34 family members. In one aspect, miR-34 sequences have a consensus sequence of SEQ ID NO:72. In one embodiment only sequences comprising the consensus sequence of WGGCAGUGUV[R]UUAGGUGRUUG (wherein the bracketed nucleotide is optional) (SEQ ID NO: 73) will be included with all other miRNAs excluded. The term miR-34 includes all members of the miR-34 family unless specifically identified. In certain aspects, a subset of these miRNAs will be used that include some but not all of the listed miR-34 family members. For instance, in one embodiment only sequences comprising the consensus sequence of SEQ ID NO: 73 will be included with all other miRNAs excluded.

[0015] In a further aspect, a "miR-34 nucleic acid sequence" includes all or a segment of the full length precursor of miR-34 family members. Stem-loop sequences of miR-34 family members include hsa-mir-34a GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGA GCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGC ACGUUGUGGGGCCC (MI0000268; SEQ ID NO:35); hsa-mir-34b GUGCUCGG UUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCAC UAACUCCACUGCCAUCAAAACAAGGCAC (MI0000742; SEQ ID NO:36); hsa-

mir-34c

AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAU

CACUAACCACACGGCCAGGUAAAAAGAUU (MI0000743; SEQ ID NO:37); gga-mir-34c

AGCCUGGUUACCAGGCAGUGUAGUUAGCUGAUUGCCACCAGGACCAA

UCACUAACCACACAGCCAGGUAAAAAG (MIOOO1261; SEQ ID NO:38); xtr- mir-34b-4

UUCAGGCAGUGUAGUUAGCUGAUUGUGUUAUAUCAAAUUUGCAAU

CACUAGCUAAACUACCAUAAAA (MI0004818; SEQ ID NO:39); age-mir-34a

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGU

GCAAUAGUGAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUG

CACGUUGUGGGGCCC (MI0002797; SEQ ID NO:40); ptr-mir-34a

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGA

GCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGC

ACGUUGUGGGGCCC (MI0002800; SEQ ID NO:41); bta-mir-34b

GUGCUCGGUUUGUAGGCAGUGUAAUUAGCUGAUUGUACUCUCAUGCUU

ACAAUCACUAGUUCCACUGCCAUCAAAACAAGGCAC (MI0004763; SEQ ID

NO:42); mne-mir-34a GGCCAGCUGUGAGUGUUUCUUUGG

CAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCA

AGUAUACUGCCCUAGAAGUGCUACACAUUGUGGGGCCU (MI0002804; SEQ

ID NO:43); gga-mir-34b GUGCUUGGUUUGCAGGCAGUGUAGUUAGCUG

AUUGUACCCAGCGCCCCACAAUCACUAAAUUCACUGCCAUCAAAACAAG

GCAC (MIOOO 1260; SEQ ID NO:44); rno-mir-34c AGUCUAGUUACUAGG

CAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACAGCC

AGGUAAAAAGACU (MI0000876; SEQ ID NO:45); xtr-mir-34b-2

UUCAGGCAGUGU

AGUUAGCUGAUUGUGUUAUAUCAAAUUUGCAAUCACUAGCUAAACUAC

CAUAAAA (MI0004817; SEQ ID NO:46); xtr-mir-34a CUGUGAGUGUU

UCUUUGGCAGUGUCUUAGCUGGUUGUUGUGGCACGUUAUAGAAGUAGC

AAUCAGCAAAUAUACUGCCCUAGAAGUUCUGCACAUU (MI0004816; SEQ

ID NO:47); mmu-mir-34c

AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUG

CUAAUAGUACCAAUCACUAACCACACAGCCAGGUAAAAAGACU

(MI0000403; SEQ ID NO:48); lla-mir-34a

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUU

AGCUGGUUGUUGUGAGCAAUAGUGAAGGAAGCAAUCAGCAAGUAUACU

GCCCUAGAAGUGCUGCACGUUGUGGGGCCC (MI0002803; SEQ ID NO:49); bmo-mir-34

AGAAUCAGGGUAGACCGCGUUGGCAGUGUGGUUAGCUGGUUGUG

UAUGGAAAUGACAACAGCCACUAACGACACUGCUCCUGCGUGCACCCUA

AAUCA (MI0004975; SEQ ID NO:50); sla-mir-34a GGCCGGCU

GUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGU

GAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGU

GGGGCCC (MI0002802; SEQ ID NO:51); dre-mir-34c UGCUGUGUGGUCA

CCAGGCAGUGCAGUUAGUUGAUUACAAUCCAUAAAGUAAUCACUAACC

UCACUACCAGGUGAAGGCUAGUA (MI0004774; SEQ ID NO:52); rno-mir-34b

GUGCUCGGUUUGUAGGCAGUGUAAUUAGCUGAUUGUAGUGCGGUGCUG

ACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC (MI0000875; SEQ ID

NO:53); mdo-mir-34a

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCU

GGUUGUUGUGAGUAAUAGAUAAGGAAGCAAUCAGCAAGUAUACUGCCC

UAGAAGUGCUGCACGUUGUUAGGCCC (MI0005280; SEQ ID NO:54); ggo- mir-34a

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGA

GCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGC

ACGUUGUGGGGCCC (MI0002796; SEQ ID NO:55); mml-mir-34a GGCCAGC

UGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAG

UAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUACACAUUGU

GGGGCCU (MI0002801; SEQ ID NO:56); dre-mir-34b GGGGUUGGU

CUGUAGGCAGUGUUGUUAGCUGAUUGUUUCAUAUGAACUAUAAUCACU

AACCAUACUGCCAACACAACAACCUACA (MI0003690; SEQ ID NO:57); dre- mir-34

CUGCUGUGAGUGGUUCUCUGGCAGUGUCUUAGCUGGUUGUUGUGUGGA

GUGAGAACGAAGCAAUCAGCAAGUAUACUGCCGCAGAAACUCGUCACCU

U (MI0001365; SEQ ID NO:58); mmu-mir-34a CCAGCUGUGA

GUAAUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGUAUUAGCUAAG

GAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACAUUGU

(MI0000584; SEQ ID NO:59); ppa-mir-34a GGC C AGCUGUG AGUGUUUCUUUG

GCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGC

AAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGCCCCC (MI0002798;

SEQ ID NO:60); rno-mir-34a

CCGGCUGUGAGUAAUUCUUUGGCAGUGUCUUAGCUGGU

UGUUGUGAGUAUUAGCUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAG

AAGUGCUGCACGUUGU (MI0000877; SEQ ID NO:61); xtr-mir-34b-l UGUUG

GGUUUUCAGGCAGUGUAGUUAGCUGAUUGUGUUAACAUAAGACUUGCA

AUCACUAGCUAAACUACCAGCAAAACUAAACA (MI0004925; SEQ ID

NO:62); ppy-mir-34a

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUG

UUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAG

UGCUGCACGUUGUGGGGCCC (MI0002799; SEQ ID NO:63); xtr-mir-34b-3

UGUUGGGUUUUCAGGCAGUGUAGUUAGCUGAUUGUGUUAACAUAAGAC

UUGCAAUCACUAGCUAAACUACCAGCAAAACUAAACA (MI0004924; SEQ

ID NO:64); cbr-mir-34

AAGCACUCAUGGUCGUGAGGCAGUGUGGUUAGCUGGUUG

CAUACACAGGUUGACAACGGCUACCUUCACUGCCACCCCGAACAUGUAG

UCCUC (MI0000494; SEQ ID NO:65); gga-mir-34a GCCAGCUGUGA

GUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUUAAG

GAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUACACAUUGUUGGG

CC (MIOOO 1251; SEQ ID NO:66); bta-mir-34c AGUCUAGUU

ACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAAUACCAAUCACUAACCA

CACGGCCAGGUAAAAAGAUU (MI0005068; SEQ ID NO:67); dps-mir-34

AAUUG

GCUAUGCGCUUUGGCAGUGUGGUUAGCUGGUUGUGUAGCCAAAAUAUU

GCCUUUGACCAUUCACAGCCACUAUCUUCACUGCCGCCGCGACAAGC

(MI0001317;SEQ ID NO:68); dme-mir-34 AAUUGGCUAUGCGCUUUGGC

AGUGUGGUUAGCUGGUUGUGUAGCCAAUUAUUGCCGUUGACAAUUCAC

AGCCACUAUCUUCACUGCCGCCGCGACAAGC (MI0000371; SEQ ID NO:69); mmu-mir-34b

GUGCUCGGUUUGUAGGCAGUGUAAUUAGCUGAUUGUAGUGCGG

UGCUGACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC (MI0000404;

SEQ ID NO:70); cel-mir-34 CGGACAAUGCUCGAGAGGCAGUGUGGUUA

GCUGGUUGCAUAUUUCCUUGACAACGGCUACCUUCACUGCCACCCCGAA

CAUGUCGUCCAUCUUUGAA (MI0000005; SEQ ID NO:71) or a complement thereof.

[0016] In certain aspects, a nucleic acid miR-34 nucleic acid, or a segment or a mimetic thereof, will comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides of the precursor miRNA or its processed sequence, including all ranges and integers there between. In certain embodiments, the miR-34 nucleic acid sequence contains the full-length processed miRNA sequence and is referred to as the "miR-34 full-length processed nucleic acid sequence." In still further aspects, a miR-34 comprises at least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50 nucleotide (including all ranges and integers there between) segment of miR-34 that is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs provided herein.

[0017] In specific embodiments, a miR-34 or miR-34 inhibitor containing nucleic acid is hsa-miR-34 or hsa-miR-34 inhibitor, or a variation thereof. miR-34 can be hsa-miR-34a or hsa-miR-34b or hsa-miR-34c. In a further aspect, a miR-34 nucleic acid or miR-34 inhibitor can be administered with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miRNAs or miRNA inhibitors. miRNAs or their complements can be administered concurrently, in sequence, or in an ordered progression. In certain aspects, a miR-34 or miR-34 inhibitor can be administered in combination with one or more of a let-7, let-7b, let-7c, let-7g, miR-15, miR-16, miR-20, miR-21, miR-26a, miR-124a, miR- 126, miR-143, miR-147, miR-188, miR-200, miR-215, miR-216, miR-292-3p, and/or miR-331 nucleic acid. All or combinations of miRNAs or inhibitors thereof may be administered in a single formulation. Administration may be before, during or after a second therapy.

[0018] miR-34 nucleic acids or complements thereof may also include various heterologous nucleic acid sequence, i.e., those sequences not typically found operatively coupled with miR-34 in nature, such as promoters, enhancers, and the like. The miR-34 nucleic acid is a recombinant nucleic acid, and can be a ribonucleic acid or a deoxyribonucleic acid. The recombinant nucleic acid may comprise a miR- 34 or miR-34 inhibitor expression cassette, i.e., a nucleic acid segment that expresses a nucleic acid when introduce into an environment containing components for nucleic acid synthesis. In a further aspect, the expression cassette is comprised in a viral

vector, or plasmid DNA vector or other therapeutic nucleic acid vector or delivery vehicle, including liposomes and the like. In certain aspects a nucleic acid is a RNA and/or a synthetic nucleic acid. In a particular aspect, the miR-34 nucleic acid is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic. In certain aspects, viral vectors can be administered at 1x10 , IxIO3, IxIO4 IxIO5, IxIO6, IxIO7, IxIO8, IxIO9, IxIO10, IxIO11, IxIO12, IxIO13, IxIO14 pfu or viral particle (vp).

[0019] In a particular aspect, the miR-34 nucleic acid or miR-34 inhibitor is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic. In still further aspects, a DNA encoding such a nucleic acid of the invention can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50, 100, 200, 400, 600, 800, 1000, 2000, to 4000 μg or mg, including all values and ranges there between. In yet a further aspect, nucleic acids of the invention, including synthetic nucleic acid, can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50, 100, to 200 μg or mg per kilogram (kg) of body weight. Each of the amounts described herein may be administered over a period of time, including 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, minutes, hours, days, weeks, months or years, including all values and ranges there between.

[0020] In certain embodiments, administration of the composition(s) can be enteral or parenteral. In certain aspects, enteral administration is oral. In further aspects, parenteral administration is intralesional, intravascular, intracranial, intrapleural, intratumoral, intraperitoneal, intramuscular, intralymphatic, intraglandular, subcutaneous, topical, intrabronchial, intratracheal, intranasal, inhaled, or instilled. Compositions of the invention may be administered regionally or locally and not necessarily directly into a lesion.

[0021] In certain aspects, the gene or genes modulated comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200 or more genes or combinations of genes identified in Tables 1, 3, 4, and/or 5. In still further aspects, the gene or genes modulated may exclude 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 175 or more genes or combinations of genes identified in Tables 1, 3, 4, and/or 5. Modulation includes modulating transcription, mRNA levels, mRNA translation, and/or protein levels in a cell, tissue, or organ. In

certain aspects the expression of a gene or level of a gene product, such as mRNA or encoded protein, is down-regulated or up-regulated. In a particular aspect the gene modulated comprises or is selected from (and may even exclude) 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26. 27, 28, or all of the genes identified in Tables 1, 3, 4, and/or 5, or any combinations thereof. In certain embodiments a gene modulated or selected to be modulated is from Table 1. In further embodiments a gene modulated or selected to be modulated is from Table 3. In still further embodiments a gene modulated or selected to be modulated is from Table 4. In yet further embodiments a gene modulated or selected to be modulated is from Table 5. Embodiments of the invention may also include obtaining or assessing a gene expression profile or miRNA profile of a target cell prior to selecting the mode of treatment, e.g., administration of a miR-34 nucleic acid, inhibitor of miR-34, or mimetics thereof... The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application. In certain aspects of the invention one or more miRNA or miRNA inhibitor may modulate a single gene. In a further aspect, one or more genes in one or more genetic, cellular, or physiologic pathways can be modulated by one or more miRNAs or complements thereof, including miR-34 nucleic acids and miR-34 inhibitors in combination with other miRNAs.

[0022] miR-34 nucleic acids may also include various heterologous nucleic acid sequence, i.e., those sequences not typically found operatively coupled with miR-34 in nature, such as promoters, enhancers, and the like. The miR-34 nucleic acid is a recombinant nucleic acid, and can be a ribonucleic acid or a deoxyribonucleic acid. The recombinant nucleic acid may comprise a miR-34 expression cassette. In a further aspect, the expression cassette is comprised in a viral, or plasmid DNA vector or other therapeutic nucleic acid vector or delivery vehicle, including liposomes and the like. In a particular aspect, the miR-34 nucleic acid is a synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully or partially synthetic.

[0023] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-34 nucleic acid sequence in an amount

sufficient to modulate the expression, function, status, or state of a cellular pathway, in particular those pathways described in Table 2 or the pathways known to include one or more genes from Table 1, 3, 4, and/or 5. Modulation of a cellular pathway includes, but is not limited to modulating the expression of one or more gene. Modulation of a gene can include inhibiting the function of an endogenous miRNA or providing a functional miRNA to a cell, tissue, or subject. Modulation refers to the expression levels or activities of a gene or its related gene product or protein, e.g., the mRNA levels may be modulated or the translation of an mRNA may be modulated, etc. Modulation may increase or up regulate a gene or gene product or it may decrease or down regulate a gene or gene product.

[0024] Still a further embodiment includes methods of treating a patient with a pathological condition comprising one or more of step (a) administering to the patient an amount of an isolated nucleic acid comprising a miR-34 nucleic acid sequence in an amount sufficient to modulate the expression of a cellular pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway sensitizes the patient to the second therapy. A cellular pathway may include, but is not limited to one or more pathway described in Table 2 below or a pathway that is know to include one or more genes of Tables 1, 3, 4, and/or 5. A second therapy can include administration of a second miRNA or therapeutic nucleic acid, or may include various standard therapies, such as chemotherapy, radiation therapy, drug therapy, immunotherapy, and the like. Embodiments of the invention may also include the determination or assessment of a gene expression profile for the selection of an appropriate therapy.

[0025] Embodiments of the invention include methods of treating a subject with a pathological condition comprising one or more of the steps of (a) determining an expression profile of one or more genes selected from Table 1, 3, 4, and/or 5; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using selected therapy. Typically, the pathological condition will have as a component, indicator, or result the mis-regulation of one or more gene of Table 1, 3, 4, and/or 5.

[0026] Further embodiments include the identification and assessment of an expression profile indicative of miR-34 status in a cell or tissue comprising expression

assessment of one or more gene from Table 1, 3, 4, and/or 5, or any combination thereof.

[0027] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA- based gene regulation. See, e.g., Carrington et ah, 2003, which is hereby incorporated by reference. The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself.

[0028] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker in the sample {e.g., a plurality of nucleic acid probes that identify one or more markers from Tables 1, 3, 4, and/or 5); it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well know to one of ordinary skill in the art. The difference in the expression profile in the sample from the patient and a reference expression profile, such as an expression profile from a normal or non-pathologic sample, is indicative of a pathologic, disease, or cancerous condition. A nucleic acid or probe set comprising or identifying a segment of a corresponding mRNA can include all or part of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more nucleotides, including any integer or range derivable there between, of a gene, genetic marker, a nucleic acid, mRNA or a probe representative thereof that is listed in Tables 1, 3, 4, and/or 5 or identified by the methods described herein.

[0029] Certain embodiments of the invention are directed to compositions and methods for assessing, prognosing, or treating a pathological condition in a patient

comprising measuring or determining an expression profile of one or more marker(s) in a sample from the patient, wherein a difference in the expression profile in the sample from the patient and an expression profile of a normal sample or reference expression profile is indicative of pathological condition and particularly cancer (e.g., In certain aspects of the invention, the cellular pathway, gene, or genetic marker is or is representative of one or more pathway or marker described in Table 1, 3, 4, and/or 5, including any combination thereof.

[0030] Aspects of the invention include diagnosing, assessing, or treating a pathologic condition or preventing a pathologic condition from manifesting. For example, the methods can be used to screen for a pathological condition; assess prognosis of a pathological condition; stage a pathological condition; assess response of a pathological condition to therapy; or to modulate the expression of a gene, genes, or related pathway as a first therapy or to render a subject sensitive or more responsive to a second therapy. In particular aspects, assessing the pathological condition of the patient can be assessing prognosis of the patient. Prognosis may include, but is not limited to an estimation of the time or expected time of survival, assessment of response to a therapy, and the like. In certain aspects, the altered expression of one or more gene or marker is prognostic for a patient having a pathologic condition, wherein the marker is one or more of Table 1, 3, 4, and/or 5, including any combination thereof.

Table 1. Genes with increased (positive values) or decreased (negative values) expression following transfection of human cancer cells with pre-miR hsa-miR-

34a.

Gene Symbol RefSeq Transcript ID (Pruitt et al, 2005) Δ log2

15E1.2 NMJ76818 -0.855883

AADAC NM 001086 1.4245

ABAT NM 000663 /// NM 020686 2.09337

ABCAl NM_005502 1.74697

ABCB6 ///

ATG9A NM 005689 /// NM 024085 -1.58186

ABHD3 NM 138340 0.867787

ABLIM3 NM 014945 1.3482

NM 001033049 /// NM 001112 /// NM 015833 ///

ADARBl NM 015834 0.842409

ADM NM 001124 1.0206

ADRB2 NM 000024 0.987993

AER61 NM 173654 1.06132

AGR2 NM 006408 -0.735648

AIP NM 003977 -0.81314

AKAP 12 NM 005100 /// NM_144497 1.06844

AKAP2 ///

PALM2-AKAP2 NM 001004065 /// NM 007203 /// NM 147150 1.41369

AMBP NM_ 001633 1.8111

ANG ///

RNASE4 NM 001145 /// NM 002937 /// NM 194430 /// NM 194431 -1.06683

ANK3 NM 001149 /// NM 020987 -1.95944

ANKRD46 NM 198401 2.27544

ANXAlO NM 007193 1.47535

ANXA6 NM_ 001155 /// NM 004033 1.04941

AOXl NM 001159 0.985795

APBA2BP NM 031231 /// NM 031232 1.38542

APBB2 NM 173075 1.01175

APOH NM 000042 -1.01185

APOLl NM 003661 /// NM 145343 /// NM 145344 1.41657

APOL2 NM 030882 /// NM 145637 1.32603

APOL6 NM 030641 1.01053

APP NM 000484 /// NM 201413 /// NM 201414 0.81516

APPBP2 NM 006380 1.03917

AQP3 NM 004925 -0.829627

ARAF NM 001654 -1.33921

AREG NM 001657 -2.00723

ARHGAPl NM 004308 -1.34595

ARHGDIA NM 004309 -1.3822

ARHGDIB NM 001175 0.78956

ARL2BP NM_ 012106 1.41631

ARMC9 NM 025139 1.27907

ARTS-I NM 016442 0.777184

ATF3 NM 001030287 /// NM 001674 /// NM 004024 0.803548

ATF5 NM 012068 -0.820316

ATP1B3 NM 001679 -1.26175

ATP6V0E NM 003945 1.62158

ATRX NM 000489 /// NM 138270 /// NM 138271 0.701236

ATXNl NM 000332 0.762227

AURKB NM 004217 -1.21558

AVPIl NM 021732 -1.15695

AXL NM 001699 /// NM 021913 -1.04756

B3GNT6 NM 006876 0.742494

B4GALT1 NM 001497 -1.09541

BASPl NM 006317 -1.09986

BCLlO NM 003921 0.945297

BCL2A1 NM_ 004049 1.79572

BEAN XM 375359 1.43239

BFSPl NM 001195 1.83387

BIRC3 NM 001165 /// NM 182962 1.38727

BIRC5 NM 001012270 /// NM 001012271 /// NM 001168 -1.24824

NM 007294 /// NM 007295 /// NM 007296 /// NM 007297 ///

BRCAl NM 007298 /// NM 007299 -1.22874

BRCA2 NM 000059 -1.1312

BRD4 NM 014299 /// NM 058243 -1.07112

BTN3A2 NM 007047 1.0274

BUBl NM 004336 -0.713041

ClOorfό NM 018121 1.01113

Cl lor© NM~ "013279 -1.08113

C14orf45 NM~ "025057 2.47389

C14orf87 NM~ 016417 -1.18865

C16orβ5 NM~ "012075 -1.19951

C19orf21 NM~ 173481 -1.30656

Clorfl21 NM" "016076 -1.21093

ClQLl NM" "006688 -1.26437

ClR NM" 001733 1.02369

C20orf27 NM" "017874 -1.14465

C20orf28 NM" 015417 1.30003

C3 NM" "000064 0.937791

C5orfl3 NM" 004772 -1.07726

C5orfl5 NM^ "020199 0.944249

C8orfl NM 004337 0.861254

C9orfl l6 NM" 144654 1.38283

C9orf9 NM" "018956 1.421

C9orf95 NM" 017881 1.55696

CAI l NM" "001217 -1.18345

CA8 NM" 004056 1.55625

NM" "012189 /// NM 138643 /// NM 138644 /// NM 153768 ///

CABYR NM" "153769 /// NM 153770 1.04961

NM" "018896 /// NM 198376 /// NM 198377 /// NM 198378 ///

CACNAlG NM" "198379 /// NM 198380 -0.901954

CALMl NM" "006888 0.813961

CAPl NM" "006367 -0.896135

CAP2 NM" 006366 1.09193

CASP2 NM" "001224 /// NM 032982 /// NM 032983 -1.28474

CASP7 NM" "001227 /// NM 033338 /// NM_033339 /// NM_033340 1.03974

CCL2 "002982 1.36514

CCL20 NM 004591 1.62138

CCNA2 NM" 001237 -1.41379

CCNDl NM" "053056 -0.930676

CCND3 NM" 001760 -0.771789

CDC23 NM" "004661 -1.32857

CDC42BPA NM" 003607 /// NM 014826 0.74279

CDCPl NM" "022842 /// NM 178181 1.1641

CDH 17 NM" "004063 -1.03903

CDK4 NM" "000075 -1.76673

CDK5R1 NM" "003885 1.09117

CDKN2C NM" 001262 /// NM 078626 -0.851676

CDKN3 NM" "005192 -1.19066

CDR2 NM" 001802 1.24562

CDSl NM" "001263 0.88342

Cep290 NM" 025114 0.813496

CFH 000186 /// NM 001014975 -1.05346

CFH /// CFHLl NM "000186 /// NM 001014975 /// NM_002113 -1.6016

CFLAR NM" "003879 1.07147

CGI-48 NM" "016001 1.12004

CHAFlA NM" 005483 -1.42704

CHESl NM" "005197 -2.11775

CHGB NM" 001819 -0.857594

CHSTI l NM" "018413 1.40436

CLCN4 NM" 001830 1.14064

CLDNl NM 021101 1.28975

CLDN3 NM 001306 0.900833

CLDN4 NM 001305 1.28122

CLN8 NM 018941 1.24729

CLU NM 001831 /// NM _203339 0.953076

CMAS NM 018686 1.01336

CMKORl NM 020311 2.19002

COLI lAl NM 001854 /// NM 080629 /// NM 080630 1.3148

NM 005203 /// NM" "080798 /// NM" 080799 /// NM_080800 ///

COL13A1 NM 080801 /// NM" j)80802 0.853876

COL4A1 NM 001845 1.56564

COL5A1 NM 000093 1.15906

COL6A1 NM 001848 1.59125

COL6A2 NM_ 001849 /// NM _058174 /// NM_ _058175 2.06239

COL7A1 NM 000094 0.793168

CPSl NM 001875 -2.32498

CPT2 NM 000098 1.00281

CRIP2 NM 001312 -0.922219

CRISPLD2 NM_ 031476 2.81469

NM 006140 /// NM 172245 /// NM 172246 /// NM_172247 ///

CSF2RA NM 172248 /// NM" "172249 1.00137

CTDSPL NM 001008392 /// NM 005808 -1.2227

CTGF NM 001901 2.2556

CTH NM 001902 /// NM 153742 0.748163

CTNNDl NM 001331 -1.28384

NM 001908 /// NM _147780 /// NM_ _147781 /// NMJ 47782 ///

CTSB NM 147783 -1.17728

CTSS NM 004079 1.6643

CXCLl NM 001511 1.86327

CXCL2 NM_ 002089 0.973392

CXCL3 NM 002090 1.63863

CXCL5 NM 002994 1.64645

CXCR4 NM 001008540 /// NM 003467 2.06112

CXXl NM 003928 -1.38111

CYB5-M NM_ 030579 -1.01749

CYP2C19 ///

CYP2C9 NM 000769 /// NM 000771 1.17496

CYP2C9 NM 000771 1.05268

CYP2R1 NM 024514 -1.13015

CYP3A5 NM 000777 1.13947

CYP4F11 NM 021187 0.775712

CYR61 NM 001554 1.08188

D2LIC NM 001012665 /// NM 015522 /// NM 016008 1.14403

DCBLD2 NM 080927 0.827395

DCP2 NM_ 152624 2.01114

DDAHl NM 012137 1.95701

DDC NM 000790 -0.79769

DDX3Y NM 004660 1.33289

DDX58 NM 014314 1.23454

DGATl NM 012079 -1.47631

DHFR NM 000791 -1.11281

DIPA NM_ 006848 -1.01009

DKFZP564B147 ___ -1.39981

DKFZP564J102 NM 001006655 /// NM 015398 1.24965

DKFZp564K142 NM 032121 -1.75645

DKK3 NM 001018057 /// NM 013253 /// NM 015881 1.3607

DNAJB4 NM 007034 1.02763

DOCK4 NM 014705 1.59892

DPYSL3 NM 001387 1.11349

DSU NM 018000 1.07415

DTL NM 016448 -1.32027

DTYMK NM 012145 -1.11353

DUSPlO NM 007207 /// NM 144728 /// NM 144729 1.01454

DUSP6 NM 001946 /// NM 022652 1.14972

E2F5 NM 001951 -1.68328

E2F8 NM 024680 -1.2799

EEFlD NM 001960 /// NM 032378 0.808336

EFHD2 NM_024329 -1.13016

EHF NM 012153 0.820509

EI24 NM 001007277 /// NM 004879 -0.767372

EIF2C2 NM 012154 1.22563

EIF3S3 NM 003756 -1.08841

ELOVL6 NM 024090 0.749146

EMLl NM 001008707 /// NM 004434 0.992653

ENO2 NM 001975 1.0967

ENTPD7 NM 020354 1.23228

F3 NM 001993 1.53096

F8 NM 000132 /// NM 019863 -1.39114

F8A1 NM 012151 -1.18147

FA2H NM 024306 0.714692

FAM 18B NM 016078 1.0362

FAM63B NM_019092 1.02997

NM 000043 /// NM 152871 /// NM 152872 /// NM 152873 ///

FAS NM_152874 /// NM_152875 0.737731

FBNl NM 000138 1.06594

FBN2 NM 001999 1.11832

FBXO 17 NM 024907 /// NM 148169 -1.12512

FBXO5 NM 012177 -1.05957

FCHOl NM 015122 -1.09992

FENl NM 004111 -1.20162

FGB NM 005141 -0.991096

FGG NM 000509 /// NM 021870 -1.78384

FKBPlB NM 004116 /// NM 054033 -0.996887

FLJl 1259 NM 018370 1.30773

FLJl 3646 NM 024584 1.0188

FLJ13868 NM 022744 -1.04136

FLJ13910 NM 022780 1.17407

FLJ13912 NM 022770 -1.55113

FLJ14054 NM 024563 1.12612

FLJl 4154 NM_024845 -1.12589

FLJ20035 NM 017631 1.07444

FLJ20232 NM 019008 -0.851064

FLJ20489 NM 017842 -1.26837

FLJ20641 NM 017915 -1.02578

FLOT2 NM 004475 -1.00905

FLRT3 NM 013281 /// NM 198391 -1.49078

FNBPl NM 015033 0.999242

FOSLl NM 005438 -1.0541

FOXMl NM 021953 /// NM 202002 /// NM 202003 -1.34628

FSTLl NM 007085 1.29027

FXYD2 NM 001680 /// NM 021603 -0.920405

FYN NM 002037 /// NM 153047 /// NM 153048 1.28966

G0S2 NM 015714 1.60366

G1P2 NM 005101 0.807471

GABRA5 NM 000810 -1.43837

GALNT 12 NM 024642 1.75421

GALNT7 NM 017423 -1.14234

GATA6 NM 005257 1.09598

GBPl NM 002053 1.32314

GCC2 NM 014635 /// NM 181453 1.23268

GFPTl NM 002056 1.19864

GFPT2 NM_005110 1.45232

GK NM 000167 /// NM 203391 0.735192

GLI2 NM 005270 /// NM 030379 /// NM 030380 /// NM 030381 -1.02394

GLIPRl NM 006851 0.816274

GLRB NM 000824 1.12977

GLS NM 014905 1.38843

GMNN NM 015895 -1.55685

GNPDAl NM 005471 -1.14252

GORASP2 NM 015530 -1.22635

GPNMB NM 001005340 /// NM 002510 -0.703249

GPR64 NM 005756 -0.77618

GRB 14 NM 004490 -1.12651

GREBl NM 014668 /// NM 033090 /// NM 148903 1.51175

GREMl NM 013372 -0.893265

GRN NM 001012479 /// NM 002087 -1.11409

GTSEl NM_016426 -1.27331

GTSEl ///

LOC440834 NM_016426 /// XM_498882 -1.0392

GYG2 NM 003918 0.926289

HAS2 NM 005328 -1.34767

HCFClRl NM 001002017 /// NM 001002018 /// NM 017885 -1.0654

HDACl NM 004964 -1.05125

HEG XM 087386 1.19039

HEGl XM 087386 1.06359

HGD NM 000187 -1.27525

HIC2 NM 015094 0.843232

HIPK3 NM 005734 0.799874

HIST1H2BC NM 003526 1.4508

HIST1H3H NM 003536 -1.03906

HLXl NM 021958 1.53759

HMGCSl NM 002130 0.733341

HMGN4 NM_006353 -1.07679

HMMR NM 012484 /// NM 012485 -1.06157

HMOXl NM 002133 0.893265

HOMER3 NM 004838 1.01188

HOXAl NM 005522 /// NM 153620 1.31491

HS3ST1 NM 005114 1.03666

HSPB8 NM 014365 1.31482

IDl NM 002165 /// NM 181353 -1.3088

ID2 NM 002166 -1.50607

ID2 /// ID2B NM 002166 -1.61007

ID3 NM 002167 -1.03804

IDH2 NM 002168 1.16927

IER3IP1 NM 016097 0.98312

IFIl 6 NM 005531 0.99528

IFIHl NM 022168 0.938476

IFITl NM 001001887 /// NM 001548 1.76266

IFRDl NM 001007245 /// NM 001550 0.812747

IFRD2 NM 006764 -1.20507

IGFBP4 NM 001552 -1.01275

ILI l NM 000641 1.10331

ILIA NM 000575 1.88862

ILlRl NM 000877 -0.832301

ILlRAP NM 002182 /// NM 134470 1.56258

IL27RA NM 004843 1.01889

NM 001012631 /// NM 001012632 /// NM 001012633 ///

IL32 NM 001012634 /// NM 001012635 2.58763

IL6ST NM 002184 /// NM 175767 1.20628

IL8 NM 000584 2.90711

INHBB NM 002193 -1.01429

INHBC NM 005538 0.916297

INSL4 NM 002195 -2.29905

IQCG NM 032263 1.29597

IRFl NM 002198 1.09282

IRF7 NM 001572 /// NM 004029 /// NM 004030 /// NM 004031 1.24714

ITGA2 NM 002203 1.3846

ITGAM NM 000632 1.03569

ITGB3 NM 000212 2.03731

ITGB6 NM 000888 1.06132

ITPR2 NM 002223 1.54371

JUN NM_002228 1.11893

KCNE4 NM 080671 1.31528

KCNK3 NM 002246 -0.767345

KCNMAl NM 001014797 /// NM 002247 1.01352

KIAAOlOl NM 001029989 /// NM 014736 -1.27609

KIAA0527 XM 171054 1.01808

KIAA0746 NM_015187 1.22625

KIAA0754 ___ 2.35948

KIAA0882 NM 015130 0.882798

KIAAl 164 NM 019092 1.35213

KIFI l NM 004523 -1.2027

KLC2 NM 022822 -0.758469

KLF4 NM 004235 -0.76891

KRT15 NM 002275 0.729419

KRT20 NM 019010 1.03241

KRT7 NM 005556 0.796089

LAMC2 NM_005562 /// NM_018891 1.19341

LARP6 NM 018357 /// NM 197958 0.84099

LASS6 NM 203463 -1.05783

LEPR NM 001003679 /// NM 001003680 /// NM 002303 1.42733

LEPRELl NM 018192 -0.824854

LGR4 NM 018490 -1.37431

LHX2 NM 004789 -0.793849

LITAF NM 004862 -1.40923

LMANl NM 005570 -1.21429

LMAN2L NM 030805 -1.16601

LMO4 NM 006769 -1.1335

LNK NM 005475 1.36739

LOC137886 XM 059929 -0.909709

LOC146909 XM 085634 -1.13528

LOC492304 NM 001007139 1.00913

LOC54103 NM 017439 1.16544

LOC93349 NM 138402 1.36353

LOXL2 NM 002318 0.949739

LPINl NM 145693 0.823449

LRP 12 NM 013437 0.734031

NM 001018054 /// NM 004631 /// NM 017522 ///

LRP8 NM_033300 1.22738

LRRC40 NM 017768 -1.24993

LRRC48 NM 031294 1.14188

LRRC54 NM 015516 -1.2155

LSM2 NM 021177 -1.23146

LUM NM 002345 -0.973319

LY6E NM 002346 -1.06222

LYPDl NM 144586 0.70258

LYST NM 000081 /// NM 001005736 1.42511

LZTFLl NM 020347 1.40668

MAFF NM 012323 /// NM 152878 2.14921

MAPlB NM 005909 /// NM 032010 1.22773

MAP3K1 XM 042066 1.11883

MAP3K11 NM 002419 -1.57495

MAP7 NM 003980 -1.28946

MARCH8 NM 001002265 /// NM 001002266 /// NM 145021 -1.25289

MCAM NM_006500 1.0908

MCLl NM 021960 /// NM 182763 1.03645

MCMlO NM 018518 /// NM 182751 -1.04264

MCM2 NM 004526 -1.57773

MCM3 NM 002388 -1.51854

MCM5 NM 006739 -1.91411

MEG3 XR 000167 /// XR 000277 1.08666

MERTK NM 006343 1.0367

MET NM 000245 -1.20442

MFN2 NM 014874 -0.815974

MGAM NM 004668 0.708327

MGC35048 NM 153208 1.00046

MGC5508 NM_024092 -1.37543

MGC5618 ___ 1.1505

MICALl NM 022765 1.12473

MKI67 NM 002417 -1.30259

MKLl NM_020831 -1.03444

MLFl NM 022443 0.859795

MMP7 NM 002423 1.42996

MPHOSPH6 NM 005792 -1.07128

NM 001001924 /// NM 001001925 /// NM 001001927 ///

MTUSl NM 001001931 /// NM 020749 -1.42746

MXD4 NM 006454 1.0247

MYBL2 NM 002466 -1.10263

MYL5 NM 002477 1.66702

MYL9 NM 006097 /// NM 181526 0.803112

NM 001033053 /// NM 014922 /// NM 033004 ///

NALPl NM 033006 /// NM 033007 2.07583

NAP1L3 NM 004538 1.09345

NAV3 NM 014903 0.770001

NCF2 NM 000433 2.29517

NEFL NM 006158 1.17139

NFl NM 000267 -0.778589

NM 000268 /// NM 016418 /// NM _181825 /// NM_181826 ///

NF2 NM 181827 /// NM~ J81828 1.00874

NFE2L3 NM 004289 1.08319

NFKB2 NM 002502 1.35547

NFYC NM 014223 -1.09134

NIDI NM 002508 1.17206

NINJl NM 004148 -1.06946

NMT2 NM 004808 1.02347

NMU NM 006681 -1.88419

NNMT NM 006169 0.739662

NPCl NM 000271 0.893962

NPR3 NM 000908 1.52387

NPTXl NM 002522 -1.77152

NRl D2 NM 005126 0.808897

NR4A2 NM 006186 /// NM 173171 /// NM 173172 /// NM 173173 -1.74346

NM 003872 /// NM~ "018534 /// NM _201264 /// NM_201266 ///

NRP2 NM 201267 /// NM~ ^201279 1.23016

NT5E NM 002526 1.91748

NUCKS NM 022731 1.3771

NUMAl NM 006185 -1.01356

NUP210 NM 024923 -1.4912

NXN NM 022463 1.0689

OBSLl XM 051017 0.804699

OLFMl NM 006334 /// NM _014279 /// NM_ _058199 1.31915

OLRl NM 002543 1.31356

OPLAH NM 017570 1.35807

NM 001008211 /// NM 001008212 /// NM_001008213 ///

OPTN NM 021980 0.915075

OSTMl NM 014028 1.16133

OXTR NM 000916 1.33936

P4HA2 NM 001017973 /// NM 001017974 /// NM_004199 1.251

PALM2-AKAP2 NM 007203 /// NM 147150 1.06286

NM 152911 /// NM~ "207125 /// NM _207126 /// NM_207127 ///

PAOX NM 207128 /// NM~ ^207129 1.32238

PARP 12 NM 022750 1.27777

PBXl NM 002585 -1.08862

PCDH9 NM 020403 /// NM 203487 -1.05152

PCTKl NM 006201 /// NM~ 033018 -0.814496

PDCD2 NM 002598 /// NM~ J 44781 -0.90548

PDE4B NM 002600 -1.7473

PDE4D NM 006203 -1.12303

PDZKlIPl NM 005764 1.13804

PEFl NM 012392 -1.28292

PEGlO XM 496907 /// XM _499343 -1.64969

PELIl NM 020651 1.0763

PER2 NM 003894 /// NM 022817 -1.64048

Pfs2 NM 016095 -1.22956

PGKl NM_000291 1.53422

PHTF2 NM_020432 1.08747

PICALM NM_001008660 ///NM_007166 1.1885

PIK3CD NM_005026 1.29341

PLA2G4A NM_024420 -1.19118

PLAT NM_000930 /// NM_000931 /// NM_033011 2.06312

PLAU NM_002658 1.21635

PLKl NM_005030 -1.10785

PLK2 NM_006622 1.14877

PMAIPl NM_021127 1.0331

PMCH NM_002674 0.725383

PNMA2 NM_007257 1.10051

PODXL NM_001018111///NM_005397 0.921137

POLDl NM 002691 -1.00577

PON3 NM_000940 -1.26855

PPIF NM_005729 1.61265

PPL NM_002705 0.826009

PPMlH XM_350880 0.821443

PPPlRIl NM_021959 ///NM_170781 -1.67093

PRGl NM_002727 1.04852

PRKAG2 NM_016203 1.13711

PROl 843 — 0.847903

PROSC NM 007198 -0.990835

PRRGl NM 000950 1.04821

PSFl NM_021067 -1.54127

PSMB8 NM_004159///NM_148919 1.00254

PSMB9 NM_002800///NM_l 48954 1.29194

PSME3 NM_005789///NM_l 76863 -1.18026

PTD008 NM_016145 -1.07111

PTENPl — 0.949168

PTGES NM_004878///NM_l 98797 1.11408

PTHLH NM_002820///NM_l 98964 /// NM_198965 ///NM_198966 1.17104

PTK9 NM_002822///NM_l 98974 0.721157

PTMS NM_002824 -1.31775

PTPNl 3 NM_006264 /// NM_080683 /// NM_080684 /// NM_080685 1.36372

PTPRE NM_006504///NM_l 30435 1.05644

PTX3 NM_002852 0.863389

PYCARD NM_013258///NM_145182///NM_145183 1.62445

QDPR NM_000320 -0.887924

QKI NM_006775 /// NM_206853 /// NM_206854 /// NM_206855 1.48545

R3HDM1 NM_015361 -1.54935

RABIlFIPl NM_001002233///NM_001002814///NM_025151 1.18165

RAB2 NM_002865 1.62595

RAB32 NM_006834 0.740628

RAB40B NM_006822 1.14546

RABL2B /// NM_001003789 /// NM_007081 /// NM_007082 ///

RABL2A NM_013412 1.00643

RAFTLIN NM_015150 2.59733

RAI14 NM_015577 1.02269

RARRES3 NM_004585 2.02476

RASGRPl NM_005739 1.60245

RASSF2 NM_014737///NM_170773///NM_170774 1.07132

RBLl NM_002895///NM_l 83404 -0.72568

RFC3 NM 002915 ///NM 181558 -1.20326

RFC5 NM 007370 /// NM 181578 -0.923417

RGS2 NM 002923 0.835083

RGS20 NM 003702 /// NM 170587 0.993551

RHEB NM 005614 1.18155

RHOB NM 004040 0.954741

RHOBTBl NM_001032380 /// NM_014836 /// NMJ98225 0.946447

RIG ___ 1.78907

RIP NM 001033002 /// NM 032308 1.2185

RITl NM 006912 1.32862

RNASE4 NM 002937 /// NM 194430 /// NM 194431 -1.4534

RP2 NM 006915 2.06464

RPL38 NM 000999 1.08656

RPSI l NM 001015 0.858194

RPS6KA5 NM_004755 /// NM_182398 1.22551

RRAD NM 004165 0.849368

RRAS NM 006270 -1.79851

RRM2 NM 001034 -0.831449

RSADl NM 018346 -0.772167

SlOOP NM 005980 -0.746607

SAC3D1 NM 013299 -1.247

SAMD4 NM 015589 1.21723

SCMLl NM 006746 0.853621

SCYL3 NM 020423 /// NM 181093 1.19418

SDCl NM 001006946 /// NM 002997 -0.818833

SEC14L1 NM 003003 1.44887

SEC23B NM 006363 /// NM 032985 /// NM 032986 1.0317

SEC24A XM 094581 1.18465

SEMA3C NM 006379 0.835585

SERPINB9 NM 004155 0.82615

SERPINEl NM_000602 1.30668

SERPINE2 NM 006216 1.32701

SGPPl NM 030791 -1.67675

SGSH NM 000199 1.00616

SH3GL1 NM 003025 -1.28343

SHCBPl NM 024745 -1.26362

SHOX2 NM 003030 /// NM 006884 0.907587

SIRTl NM 012238 -1.12384

SLCl 1A2 NM 000617 0.999393

SLClAl NM 004170 2.35948

SLC29A1 NM 004955 -1.75863

SLC35B1 NM 005827 -0.71379

SLC4A4 NM 003759 -0.800469

SLC6A6 NM 003043 1.00156

SLC7A11 NM 014331 0.710721

SLC7A5 NM 003486 -1.19768

SLCO2B1 NM_007256 1.19404

SMAD3 NM 005902 1.17331

SMURF2 NM 022739 1.68208

SNXl 6 NM 022133 /// NM 152836 /// NM 152837 1.09618

SOD2 NM 000636 /// NM 001024465 /// NM 001024466 1.45843

SOXl 8 NM 018419 1.41328

SPARC NM 003118 1.52227

SPBC25 NM 020675 -1.4866

SPFHl NM 006459 -1.8131

SPFH2 NM 001003790 /// NM 001003791 /// NM 007175 0.942632

SPHKl NM 021972 /// NM 182965 1.1223

SPTBNl NM 003128 /// NM 178313 0.857646

SQRDL NM 021199 1.28491

SRM NM 003132 -1.08855

STCl NM 003155 1.03121

STX3A NM 004177 0.728912

STYKl NM 018423 0.98547

SULTlCl NM 001056 /// NM 176825 1.99731

SUMO2 NM 001005849 /// NM 006937 1.04086

SVIL NM 003174 /// NM 021738 1.26107

SWAP70 NM 015055 1.08597

SYNCRIP NM 006372 -0.70921

SYNEl NM 015293 /// NM 033071 /// NM 133650 /// NM 182961 0.78963

SYTl NM 005639 -1.51651

TACSTDl NM 002354 -1.62205

TANK NM 004180 /// NM 133484 1.19308

TAPBPL NM 018009 1.01656

TBXASl NM 001061 /// NM 030984 1.22107

TDO2 NM 005651 0.720423

TFG NM 001007565 /// NM 006070 0.737363

TGFB2 NM 003238 0.757903

TGFBR2 NM 001024847 /// NM 003242 -0.760439

THBD NM 000361 -1.03072

TIMM 13 NM 012458 -1.00078

TJP2 NM 004817 /// NM 201629 0.721283

TKl NM 003258 -2.0118

TLRl NM 003263 2.35

TLR3 NM 003265 0.972191

TM4SF20 NM_024795 -1.36784

TM4SF4 NM 004617 -1.87733

TM7SF1 NM 003272 1.42643

TMEM45A NM 018004 -1.31309

TMEM48 NM 018087 -1.55691

TMFl NM 007114 -0.791138

TMODl NM 003275 1.92937

TNC NM 002160 1.22931

TNFAIP3 NM 006290 0.835162

TNFAIP6 NM 007115 3.25281

TNFRSF9 NM 001561 0.806509

TNRC9 XM 049037 -0.835259

TOPl NM 003286 0.756531

TP53I3 NM 004881 /// NM 147184 1.07792

TPD52 NM 001025252 /// NM 001025253 /// NM 005079 -2.00612

TPIl NM 000365 -0.72538

NM 000366 /// NM 001018004 /// NM 001018005 ///

TPMl NM 001018006 /// NM 001018007 // 1.27399

TRAl NM_003299 1.71538

TRIM 14 NM 014788 /// NM 033219 /// NM 033220 /// NM 033221 -1.15248

TRIM22 NM 006074 2.11688

TRIM8 NM 030912 1.36446

TRIO NM 007118 1.05084

TRPAl NM 007332 1.71335

TRPCl NM 003304 0.703632

TSC22D3 NM 001015881 /// NM 004089 /// NM 198057 1.09737

TSN NM 004622 -1.13575

TSPAN7 NM 004615 1.43844

TTClO NM 006531 /// NM 175605 1.19076

TTMP NM 024616 1.49839

TTRAP NM 016614 0.977696

TUBB NM 178014 -1.04629

TUBB2 NM_001069 1.31933

TUBB-

PARALOG NM 178012 1.42413

TXN NM 003329 1.56098

UBE2H NM_003344 /// NM_182697 1.12195

UBE2L3 NM 003347 /// NM 198157 -1.00846

UBE2L6 NM 004223 /// NM 198183 1.33829

UGCG NM 003358 1.01016

UROS NM 000375 -1.09209

USP46 NM 022832 0.730964

VDAC3 NM 005662 1.19978

VIL2 NM 003379 0.951191

VLDLR NM 001018056 /// NM 003383 1.49472

VPS4A NM 013245 -1.3102

WDRl 9 NM 025132 1.86855

WDR47 NM 014969 1.27531

WDR76 NM 024908 -1.09373

NM 007331 /// NM 014919 /// NM 133330 /// NM 133331 ///

WHSCl NM 133332 /// NM 133333 -0.795359

WIPI49 NM 017983 1.16833

WIZ XM_372716 -0.911496

WNT7B NM 058238 -0.755357

XBPl NM 005080 -1.02439

XTP2 NM 015172 1.01515

YKT6 NM 006555 -1.12573

YODl NM 018566 1.13406

YRDC NM 024640 0.717093

ZBTBlO NM 023929 0.894651

ZFHXlB NM 014795 1.19961

ZFYVE21 NM 024071 0.815726

ZMYM6 NM 007167 0.920391

ZNF22 NM 006963 -1.21289

ZNF232 NM 014519 -1.35052

ZNF238 NM 006352 /// NM 205768 1.09124

ZNF281 NM 012482 -0.825036

ZNF331 NM 018555 -1.18107

ZNF544 NM_014480 -1.54

ZNF551 NM 138347 -1.26671

ZNF573 NM 152360 -0.794295

ZNF580 NM 016202 /// NM 207115 -1.90207

ZNF652 NM 014897 0.911137

[0031] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an

isolated nucleic acid comprising a miR-34 nucleic acid sequence or a miR-34 inhibitor. A cell, tissue, or subject may be a cancer cell, a cancerous tissue or harbor cancerous tissue, or a cancer patient. The database content related to all nucleic acids and genes designated by an accession number or a database submission are incorporated herein by reference as of the filing date of this application.

[0032] A further embodiment of the invention is directed to methods of modulating a cellular pathway comprising administering to the cell an amount of an isolated nucleic acid comprising a miR-34 nucleic acid sequence in an amount sufficient to modulate the expression, function, status, or state of a cellular pathway, in particular those pathways described in Table 2 or the pathways known to include one or more genes from Table 1, 3, 4, and/or 5. Modulation of a cellular pathway includes, but is not limited to modulating the expression of one or more gene(s). Modulation of a gene can include inhibiting the function of an endogenous miRNA or providing a functional miRNA to a cell, tissue, or subject. Modulation refers to the expression levels or activities of a gene or its related gene product (e.g., mRNA) or protein, e.g., the mRNA levels may be modulated or the translation of an mRNA may be modulated. Modulation may increase or up regulate a gene or gene product or it may decrease or down regulate a gene or gene product (e.g., protein levels or activity).

[0033] Still a further embodiment includes methods of administering an miRNA or mimic thereof, and/or treating a subject or patient having, suspected of having, or at risk of developing a pathological condition comprising one or more of step (a) administering to a patient or subject an amount of an isolated nucleic acid comprising a miR-34 nucleic acid sequence or a miR-34 inhibitor in an amount sufficient to modulate expression of a cellular pathway; and (b) administering a second therapy, wherein the modulation of the cellular pathway sensitizes the patient or subject, or increases the efficacy of a second therapy. An increase in efficacy can include a reduction in toxicity, a reduced dosage or duration of the second therapy, or an additive or synergistic effect. A cellular pathway may include, but is not limited to one or more pathway described in Table 2 below or a pathway that is know to include one or more genes of Tables 1, 3, 4, and/or 5. The second therapy may be administered before, during, and/or after the isolated nucleic acid or miRNA or inhibitor is administered

[0034] A second therapy can include administration of a second miRNA or therapeutic nucleic acid such as a siRNA or antisense oligonucleotide, or may include various standard therapies, such as pharmaceuticals, chemotherapy, radiation therapy, drug therapy, immunotherapy, and the like. Embodiments of the invention may also include the determination or assessment of gene expression or gene expression profile for the selection of an appropriate therapy. In a particular aspect, a second therapy is a chemotherapy. A chemotherapy can include, but is not limited to paclitaxel, cisplatin, carboplatin, doxorubicin, oxaliplatin, larotaxel, taxol, lapatinib, docetaxel, methotrexate, capecitabine, vinorelbine, cyclophosphamide, gemcitabine, amrubicin, cytarabine, etoposide, camptothecin, dexamethasone, dasatinib, tipifarnib, bevacizumab, sirolimus, temsirolimus, everolimus, lonafarnib, cetuximab, erlotinib, gefitinib, imatinib mesylate, rituximab, trastuzumab, nocodazole, sorafenib, sunitinib, bortezomib, alemtuzumab, gemtuzumab, tositumomab or ibritumomab.

[0035] Embodiments of the invention include methods of treating a subject with a disease or condition comprising one or more of the steps of (a) determining an expression profile of one or more genes selected from Table 1, 3, 4, and/or 5; (b) assessing the sensitivity of the subject to therapy based on the expression profile; (c) selecting a therapy based on the assessed sensitivity; and (d) treating the subject using a selected therapy. Typically, the disease or condition will have as a component, indicator, or resulting mis-regulation of one or more gene of Table 1, 3, 4, and/or 5.

[0036] In certain aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more miRNA may be used in sequence or in combination; for instance, any combination of miR-34 or a miR-34 inhibitor with another miRNA. Further embodiments include the identification and assessment of an expression profile indicative of miR-34 status in a cell or tissue comprising expression assessment of one or more gene from Table 1, 3, 4, and/or 5, or any combination thereof.

[0037] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA- based gene regulation. See, e.g., Carrington and Ambros, 2003, which is hereby incorporated by reference. The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself.

[0038] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker or miRNA in the sample (e.g. , a plurality of nucleic acid probes that identify one or more markers from Tables 1, 3, 4, and/or 5); it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well know to one of ordinary skill in the art. The difference in the expression profile in the sample from the patient and a reference expression profile, such as an expression profile of one or more genes or miRNAs, are indicative of which miRNAs to be administered.

[0039] In certain aspects, miR-34 or miR-34 inhibitor and let-7 can be administered to patients with breast carcinoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0040] Further aspects include administering miR-34 or miR-34 inhibitor and miR-15 to patients with breast carcinoma, B-cell lymphoma, cervical carcinoma, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, lung carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0041] In still further aspects, miR-34 or miR-34 inhibitor and miR-16 are administered to patients with breast carcinoma, B-cell lymphoma, colorectal

carcinoma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0042] In certain aspects, miR-34 or miR-34 inhibitor and miR-20 are administered to patients with breast carcinoma, cervical carcinoma, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lipoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0043] Aspects of the invention include methods where miR-34 or miR-34 inhibitor and miR-21 are administered to patients with breast carcinoma, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, non- small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck.

[0044] In still further aspects, miR-34 or miR-34 inhibitor and miR-26a are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, testicular tumor.

[0045] In yet further aspects, miR-34 or miR-34 inhibitor and miR-126 are administered to patients with breast carcinoma, cervical carcinoma, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, mesothelioma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0046] In a further aspect, miR-34 or miR-34 inhibitor and miR-143 are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0047] In still a further aspect, miR-34 or miR-34 inhibitor and miR-147 are administered to patients with breast carcinoma, cervical carcinoma, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lipoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma.

[0048] In yet another aspect, miR-34 or miR-34 inhibitor and miR-188 are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0049] In yet a further aspect, miR-34 or miR-34 inhibitor and miR-200 are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, multiple myeloma, mesothelioma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0050] In other aspects, miR-34 or miR-34 inhibitor and miR-215 are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell

lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, lipoma, multiple myeloma, mesothelioma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0051] In certain aspects, miR-34 or miR-34 inhibitor and miR-216 are administered to patients with breast carcinoma, cervical carcinoma, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, prostate carcinoma, squamous cell carcinoma of the head and neck, testicular tumor.

[0052] In a further aspect, miR-34 or miR-34 inhibitor and miR-292-3p are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, lipoma, multiple myeloma, non-small cell lung carcinoma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0053] In still a further aspect, miR-34 or miR-34 inhibitor and miR-331 are administered to patients with anaplastic large cell lymphoma, breast carcinoma, B-cell lymphoma, cervical carcinoma, chronic lymphoblastic leukemia, colorectal carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia, lung carcinoma, multiple myeloma, ovarian carcinoma, oesophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, rhabdomyosarcoma, squamous cell carcinoma of the head and neck, thyroid carcinoma, testicular tumor.

[0054] It is contemplated that when miR-34 or a miR-34 inhibitor is given in combination with one or more other miRNA molecules, the two different miRNAs or inhibitors may be given at the same time or sequentially. In some embodiments, therapy proceeds with one miRNA or inhibitor and that therapy is followed up with

therapy with the other miRNA or inhibitor 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4, 5 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months or any such combination later.

[0055] Further embodiments include the identification and assessment of an expression profile indicative of miR-34 status in a cell or tissue comprising expression assessment of one or more gene from Table 1, 3, 4, and/or 5, or any combination thereof.

[0056] The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA- based gene regulation. See, e.g., Carrington and Ambros, 2003, which is hereby incorporated by reference. The term can be used to refer to the single-stranded RNA molecule processed from a precursor or in certain instances the precursor itself or a mimetic thereof.

[0057] In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying a cell or a sample containing a cell for the presence of one or more miRNA marker gene or mRNA or other analyte indicative of the expression level of a gene of interest. Consequently, in some embodiments, methods include a step of generating an RNA profile for a sample. The term "RNA profile" or "gene expression profile" refers to a set of data regarding the expression pattern for one or more gene or genetic marker in the sample (e.g., a plurality of nucleic acid probes that identify one or more markers or genes from Tables 1, 3, 4, and/or 5); it is contemplated that the nucleic acid profile can be obtained using a set of RNAs, using for example nucleic acid amplification or hybridization techniques well know to one of ordinary skill in the art. The difference in the expression profile in the sample from a patient and a reference expression profile, such as an expression profile from a normal or non-pathologic sample, or a digitized reference, is indicative of a pathologic, disease, or cancerous condition. In certain aspects the expression profile is an indicator of a propensity to or probability of (i.e., risk factor for a disease or condition) developing such a condition(s). Such a

risk or propensity may indicate a treatment, increased monitoring, prophylactic measures, and the like. A nucleic acid or probe set may comprise or identify a segment of a corresponding mRNA and may include all or part of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more segments, including any integer or range derivable there between, of a gene or genetic marker, or a nucleic acid, mRNA or a probe representative thereof that is listed in Tables 1, 3, 4, and/or 5 or identified by the methods described herein.

[0058] Certain embodiments of the invention are directed to compositions and methods for assessing, prognosing, or treating a pathological condition in a patient comprising measuring or determining an expression profile of one or more miRNA or marker(s) in a sample from the patient, wherein a difference in the expression profile in the sample from the patient and an expression profile of a normal sample or reference expression profile is indicative of pathological condition and particularly cancer (e.g., In certain aspects of the invention, the miRNAs, cellular pathway, gene, or genetic marker is or is representative of one or more pathway or marker described in Table 1, 2, 3, 4, and/or 5, including any combination thereof.

[0059] Aspects of the invention include diagnosing, assessing, or treating a pathologic condition or preventing a pathologic condition from manifesting. For example, the methods can be used to screen for a pathological condition; assess prognosis of a pathological condition; stage a pathological condition; assess response of a pathological condition to therapy; or to modulate the expression of a gene, genes, or related pathway as a first therapy or to render a subject sensitive or more responsive to a second therapy. In particular aspects, assessing the pathological condition of the patient can be assessing prognosis of the patient. Prognosis may include, but is not limited to an estimation of the time or expected time of survival, assessment of response to a therapy, and the like. In certain aspects, the altered expression of one or more gene or marker is prognostic for a patient having a pathologic condition, wherein the marker is one or more of Table 1, 3, 4, and/or 5, including any combination thereof.

Table 2. Significantly affected functional cellular pathways following hsa-miR-34a over-expression in human cancer cells.

Number Pathway Functions

Of Genes

35 Cellular Growth and Proliferation, Cellular Movement, Cell Death 35 Gene Expression, Cellular Growth and Proliferation, Cell Death 25 Gene Expression, DNA Replication, Recombination, and Repair, Cell Cycle 23 DNA Replication, Recombination, and Repair, Cell Cycle, Cellular Development 19 Cardiovascular Disease, Hematological Disease, Organismal Injury and Abnormalities 19 Cancer, Cell Cycle, Hepatic System Disease 19 Immune Response, Cell Signaling, Molecular Transport 18 Cancer, Cellular Growth and Proliferation, Neurological Disease

Immune Response, Cellular Movement, Hematological System Development and

17 Function 17 Lipid Metabolism, Molecular Transport, Small Molecule Biochemistry 17 Cell Cycle, Cancer, Cellular Growth and Proliferation

Cell-To-Cell Signaling and Interaction, Cellular Movement, Hematological System

16 Development and Function

Cellular Movement, Cellular Development, Cardiovascular System Development and

16 Function 15 Organ Development, Gene Expression, Developmental Disorder 15 Cell Death, Cancer, Cellular Growth and Proliferation 15 Carbohydrate Metabolism, Small Molecule Biochemistry, Lipid Metabolism

Cellular Assembly and Organization, Cell Cycle, Connective Tissue Development and

15 Function 15 DNA Replication, Recombination, and Repair, Gene Expression, Cancer

Hematological System Development and Function, Immune Response, Immune and

14 Lymphatic System Development and Function 14 Protein Synthesis, Cell Signaling, Nucleic Acid Metabolism

7 Cell Death, Neurological Disease, Cellular Development

1 Cellular Assembly and Organization, Cell Morphology, Cellular Compromise

Cell Cycle, Cellular Assembly and Organization, DNA Replication, Recombination,

1 and Repair 1 Cancer, Cell Death, Reproductive System Disease 1 Amino Acid Metabolism, Molecular Transport, Small Molecule Biochemistry 1 Cell Cycle, Cancer, Cell Death 1 Cell Death

Cellular Compromise, Auditory and Vestibular System Development and Function,

1 Protein Trafficking 1 Cell Morphology, Cellular Assembly and Organization, Cellular Compromise 1 Cellular Assembly and Organization, Cell Morphology, Molecular Transport

Cardiovascular System Development and Function, Organ Morphology, Neurological

Disease

Cellular Assembly and Organization, Cell Morphology, Cellular Function and

Maintenance

Cell Signaling, Molecular Transport, Neurological Disease

Table 3. Predicted target genes of hsa-miR-34a.

- Ill -

[0060] Predicted gene targets are shown in Table 3. Target genes whose mRNA expression levels are affected by hsa-miR-34 represent particularly useful candidates for cancer therapy and therapy of other diseases or conditions through manipulation of their expression levels.

[0061] Certain embodiments of the invention include determining expression of one or more marker, gene, or nucleic acid segment representative of one or more genes, by using an amplification assay, a hybridization assay, or protein assay, a variety of which are well known to one of ordinary skill in the art. In certain aspects, an amplification assay can be a quantitative amplification assay, such as quantitative RT-PCR or the like. In still further aspects, a hybridization assay can include array hybridization assays or solution hybridization assays. The nucleic acids from a sample may be labeled from the sample and/or hybridizing the labeled nucleic acid to

one or more nucleic acid probes. Nucleic acids, mRNA, and/or nucleic acid probes may be coupled to a support. Such supports are well known to those of ordinary skill in the art and include, but are not limited to glass, plastic, metal, or latex. In particular aspects of the invention, the support can be planar or in the form of a bead or other geometric shapes or configurations known in the art. Proteins are typically assayed by immunoblotting, chromatography, or mass spectrometry or other methods known to those of ordinary skill in the art.

[0062] The present invention also concerns kits containing compositions of the invention or compositions to implement methods of the invention. In some embodiments, kits can be used to evaluate one or more marker molecules, and/or express one or more miRNA or miRNA inhibitor. In certain embodiments, a kit contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 100, 150, 200 or more probes, recombinant nucleic acid, or synthetic nucleic acid molecules related to the markers to be assessed or an miRNA or miRNA inhibitor to be expressed or modulated, and may include any range or combination derivable therein. Kits may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means. Individual components may also be provided in a kit in concentrated amounts; in some embodiments, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as Ix, 2x, 5x, 10x, or 2Ox or more. Kits for using probes, synthetic nucleic acids, recombinant nucleic acids, or non-synthetic nucleic acids of the invention for therapeutic, prognostic, or diagnostic applications are included as part of the invention. Specifically contemplated are any such molecules corresponding to any miRNA reported to influence biological activity or expression of one or more marker gene or gene pathway described herein. In certain aspects, negative and/or positive controls are included in some kit embodiments. The control molecules can be used to verify transfection efficiency and/or control for transfection- induced changes in cells.

[0063] Certain embodiments are directed to a kit for assessment of a pathological condition or the risk of developing a pathological condition in a patient by nucleic acid profiling of a sample comprising, in suitable container means, two or more nucleic acid hybridization or amplification reagents. The kit can comprise reagents for labeling nucleic acids in a sample and/or nucleic acid hybridization reagents. The hybridization reagents typically comprise hybridization probes. Amplification reagents include, but are not limited to amplification primers, reagents, and enzymes.

[0064] In some embodiments of the invention, an expression profile is generated by steps that include: (a) labeling nucleic acid in the sample; (b) hybridizing the nucleic acid to a number of probes, or amplifying a number of nucleic acids, and (c) determining and/or quantitating nucleic acid hybridization to the probes or detecting and quantitating amplification products, wherein an expression profile is generated. See U.S. Provisional Patent Application 60/575,743 and the U.S. Provisional Patent Application 60/649,584, and U.S. Patent Application Serial No. 11/141,707 and U.S. Patent Application Serial No. 11/273,640, all of which are hereby incorporated by reference.

[0065] Methods of the invention involve diagnosing and/or assessing the prognosis of a patient based on a miRNA and/or a marker nucleic acid expression profile. In certain embodiments, the elevation or reduction in the level of expression of a particular gene or genetic pathway or set of nucleic acids in a cell is correlated with a disease state or pathological condition compared to the expression level of the same in a normal or non-pathologic cell or tissue sample. This correlation allows for diagnostic and/or prognostic methods to be carried out when the expression level of one or more nucleic acid is measured in a biological sample being assessed and then compared to the expression level of a normal or non-pathologic cell or tissue sample. It is specifically contemplated that expression profiles for patients, particularly those suspected of having or having a propensity for a particular disease or condition such as cancer, can be generated by evaluating any of or sets of the miRNAs and/or nucleic acids discussed in this application. The expression profile that is generated from the patient will be one that provides information regarding the particular disease or condition. In many embodiments, the profile is generated using nucleic acid hybridization or amplification, (e.g., array hybridization or RT-PCR). In certain

aspects, an expression profile can be used in conjunction with other diagnostic and/or prognostic tests, such as histology, protein profiles in the serum and/or cytogenetic assessment.

Table 5. Tumor associated mRNAs altered by hsa-miR-34a having prognostic or therapeutic value for the treatment of various malignancies.

Gene Cellular

Symbol Gene Title Process Cancer Type Reference

Akap-12/ signal CRC, PC, LC, GC, AML, (Xia et al, 2001; Wikman et al, 2002; Boultwood et al,

AKAP 12 SSeCKS/Gravin transduction CML 2004; Choi et al, 2004; Mori et al, 2006)

(Barton et al, 1997; Montero et al, 1998; Hartmann et al,

1999; Miyake et al, 1999; Shimoyama et al, 1999; Bodner-

ANG Angiogenin angiogenesis BC, OC, M, PaC, UC, Cei Adler e? α/., 2001)

(Kitadai et al, 1993; Ebert et al, 1994; Solic and Davies, signal HCC, NSCLC, MM, PC, 1997; D'Antonio et al, 2002; Bostwick et al, 2004; Ishikawa

AREG Amphiregulin transduction OC, CRC, PaC, GC et al, 2005; Mahtouk et al, 2005; Castillo et al, 2006)

AURKB/ chromosomal (Keen and Taylor, 2004; Smith et al, 2005; Chieffi et al,

STKl 2 aurora kinase B stability PC, NSCLC, BC, CRC 2006) signal

BCLlO BCL-10 transduction MALT BCL (Thome, 2004) chromosomal

K*

O BRCAl BRCA-I stability BC, OC (Wooster and Weber, 2003) chromosomal

BRCA2 BRCA-2 stability BC, OC (Wooster and Weber, 2003) chromosomal AML, SGT, ALL, HL, L, (Cahill et al, 1998; Qian et al, 2002; Ru et al, 2002;

BUBl BUBl stability CRC, GC Grabsch et al, 2003; Shigeishi et al, 2006)

CCNA2 cyclin A2 cell cycle AML (Qian et al, 2002)

MCL, BC, SCCHN, OepC, HCC, CRC, BIdC, EC, OC,

CCNDl cyclin Dl cell cycle M, AC, GB, GC, PaC (Donnellan and Chetty, 1998)

(Florenes et al, 2000; Ito et al, 2001; Filipits et al, 2002; Bai

EC, TC, BIdC, CRC, LSCC, et al, 2003; Pruned et al, 2005; Tanami et al, 2005; Lopez-

CCND3 cyclin D3 cell cycle BCL, PaC, M Beltran et al, 2006; Troncone et al, 2007; Wu et al, 2006)

G, GB, BC, LC, GC, EC, L, CDK4 CDK-4 cell cycle OS, OC, TT, HCC, CHN (Malumbres and Barbacid, 2001)

(Iolascon et al, 1998; Kulkarni et al, 2002; Morishita et al,

CDKN2C CDK inhibitor 2C cell cycle HB, MB, HCC, HL, MM 2004; Sanchez-Aguilera et al. , 2004) cell adhesion, BC, GB, OepC, RMS, CRC, (Hishikawa et al, 1999; Shimo et al, 2001; Koliopanos et al, CTGF CTGF/IGFBP-8 migration PC, 2002; Pan et al, 2002; Croci et al, 2004; Un et al, 2005;

Yang et al, 2005)

(Nupponen et al, 1999; Nupponen et al, 2000; Okamoto et

EIF3S3 eIF-3 subunit 3g translation BC, PC, HCC al, 2003)

(Moller et al, 1994; Gratas et al, 1998; Martinez-Lorenzo et

FAS Fas apoptosis NSCLC, G, L, CRC, OepC al, 1998; Shinoura e? α/., 2000; Viard-Leveugle et al, 2003) FOXMl forkhead box Ml transcription GB, LC, PC (Kalin et al, 2006; Kim et al, 2006; Liu et al, 2006)

DNA (Wohlschlegel et al, 2002; Bravou et al, 2005; Shetty et al,

GMNN Geminin replication CRC, BC, CeC 2005) HDACl HDAC-I transcription BC, PC (Kawai et al, 2003; Halkidou et al, 2004) signal BC, CRC, PaC, NSCLC, PC,

IL8 IL-8 transduction HCC (Akiba et al, 2001; Sparmann and Bar-Sagi, 2004) JUN c-Jun transcription HL, HCC (Eferl et al, 2003; Weiss and Bohmann, 2004)

(Visvader et al, 2001; Mizunuma et al, 2003; Taniwaki et

LM04 Lmo-4 transcription BC, SCCHN, SCLC al., 2006) MCAM MCAM cell adhesion M, AS, KS, LMS (Boccaccio and Comoglio, 2006)

(Krajewska ef α/., 1996; Kitada et al, 1998; Cho-Vega et al,

HCC, MM, TT, CLL, 2004; Rust et al, 2005; Sano et al, 2005; Wuilleme-Toumi et

K MCLl McI-I apoptosis ALCL, BCL, PC al, 2005; Fleischer et al, 2006; Sieghart et al, 2006) SPRC, HCC, GC, SCCHN, signal OS, RMS, GB, BC, M,

MET c-Met transduction CRC, GI, PaC, PC, OC (Boccaccio and Comoglio, 2006) myeloid leukemia MLFl factor 1 cell cycle AML (Matsumoto et al, 2000)

(Tanner et al, 2000; Bar-Shira et al, 2002; Borczuk et al, MYBL2 Myb L2 transcription BC, NSCLC, PC, OC 2003; Ginestier et al, 2006) signal NFl NF-I transduction G, AC, NF, PCC, ML (Rubin and Gutmann, 2005) Schw, TC, HCC, MG, MT

NF2 Merlin/NF-2 cell adhesion of lung (McClatchey and Giovannini, 2005) PBXl PBX-I transcription ALL (Aspland e? α/., 2001)

PI 3 -kinase IA signal

PIK3CD delta (pi 10 delta) transduction AML, MSS, GI (Vogt e? α/., 2006) NSCLC, OrpC, OepC, GC, chromosomal M, BC, OC, EC, CRC, GB, PLKl polo-like kinase 1 stability PapC, PaC, PC, HB, NHL (Strebhardt and Ullrich, 2006)

signal

RASSF2 RASSF2 transduction GQCRC, OC (Akino et al, 2005; Endoh et al, 2005; Lambros et al, 2005) (Takimoto et al, 1998; Claudio et al, 2002; Wu et al, 2002;

RBLl plO7 cell cycle BCL, PC, CRC, TC Ito et al, 2003) signal

RRAS R-RAS transduction CeC, BC (Yu and Feig, 2002; Rincon-Arano et al, 2003) signal (Zhu et al, 1998; Han et al, 2004; Liu and Matsuura, 2005;

SMAD3 SMAD-3 transduction GC, CRC, HCC, BC, ALL Yamagata et al, 2005; Yang et al, 2006) tumor-associated cell adhesion, calcium signal vesicle

TACSTDl transducer 1 trafficking NSCLC, CRC (Xi et al, 2006a; Xi et al, 2006b) signal (Krasagakis et al, 1998; Jonson et al, 2001; Nakagawa et al,

TGFB2 TGF beta-2 transduction PaC, CRC, BC, M 2004; Beisner et al, 2006) TGF beta receptor signal

TGFBR2 type II transduction BC, CRC (Markowitz, 2000; Lucke et al, 2001; Biswas et al, 2004) signal

TPD52 tumor protein D52 transduction BC, LC, PC, OC, EC, HCC (Boutros e? α/., 2004)

K* K* thioredoxin

TXN thioredoxin (trx) redox system LC, PaC, CeC, HCC (Marks, 2006) signal

WNT7B Wnt-7b transduction BC, BIdC (Huguet et al, 1994; Bui et al, 1998)

Abbreviations: AC, astrocytoma; ALCL, anaplastic large cell lymphoma; ALL, acute lymphoblastic leukemia; AML, acute myeloid leukemia; AS, angiosarcoma; BC, breast carcinoma; BCL, B-cell lymphoma; BIdC, bladder carcinoma; CeC, cervical carcinoma; CHN, carcinoma of the head and neck; CLL, chronic lymphocytic leukemia; CML, chronic myeloid leukemia; CRC, colorectal carcinoma; EC, endometrial carcinoma; G, glioma; GB, glioblastoma; GC, gastric carcinoma; GI, gastrinoma; HB, hepatoblastoma; HCC, hepatocellular carcinoma; HL, Hodgkin lymphoma; KS, Kaposi's sarcoma; L, leukemia; LC, lung carcinoma; LMS, leiomyosarcoma; LSCC, laryngeal squamous cell carcinoma; M, melanoma; MALT BCL, mucosa-associated lymphoid tissue B-cell lymphoma; MB, medulloblastoma; MCL, mantle cell lymphoma; MG, meningioma; ML, myeloid leukemia; MM, multiple myeloma; MSS, high-risk myelodysplastic syndrome; MT, mesothelioma; NF, neurofibroma; NHL, non-Hodgkin lymphoma; NSCLC, non-small cell lung carcinoma; OC, ovarian carcinoma; OepC, esophageal carcinoma; OrpC, oropharyngeal carcinoma; OS, osteosarcoma; PaC, pancreatic carcinoma; PapC, papillary carcinoma; PC, prostate carcinoma; PCC, pheochromocytoma; RMS, rhabdomyosarcoma; SCCHN, squamous cell carcinoma of the head and neck; Schw, schwannoma; SCLC, small cell lung cancer; SGT, salivary gland tumor; SPRC, sporadic papillary renal carcinoma; TC, thyroid carcinoma; TT, testicular tumor; UC, urothelial carcinoma

[0066] The methods can further comprise one or more of the steps including: (a) obtaining a sample from the patient, (b) isolating nucleic acids from the sample, (c) labeling the nucleic acids isolated from the sample, and (d) hybridizing the labeled nucleic acids to one or more probes. Nucleic acids of the invention include one or more nucleic acid comprising at least one segment having a sequence or complementary sequence of to a nucleic acid representative of one or more of genes or markers in Table 1, 3, 4, and/or 5.

[0067] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. It is specifically contemplated that any methods and compositions discussed herein with respect to miRNA molecules, miRNA, genes, and Certain embodiments of the invention include determining expression of one or more marker, gene, or nucleic acid representative thereof, by using an amplification assay, a hybridization assay, or protein assay, a variety of which are well known to one of ordinary skill in the art. In certain aspects, an amplification assay can be a quantitative amplification assay, such as quantitative RT-PCR or the like. In still further aspects, a hybridization assay can include array hybridization assays or solution hybridization assays. The nucleic acids from a sample may be labeled from the sample and/or hybridizing the labeled nucleic acid to one or more nucleic acid probes. Nucleic acids, mRNA, and/or nucleic acid probes may be coupled to a support. Such supports are well known to those of ordinary skill in the art and include, but are not limited to glass, plastic, metal, or latex. In particular aspects of the invention, the support can be planar or in the form of a bead or other geometric shapes or configurations known in the art. Protein are typically assayed by immunoblotting, chromatography, or mass spectrometry or other methods known to those of ordinary skill in the art.

[0068] The present invention also concerns kits containing compositions of the invention or compositions to implement methods of the invention. In some embodiments, kits can be used to evaluate one or more marker molecules, and/or express one or more miRNA. In certain embodiments, a kit contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 100, 150, 200 or more probes, recombinant nucleic acid, or synthetic nucleic acid molecules related to the markers to be assessed or an miRNA to be expressed or modulated, and may include any range or combination derivable therein. Kits may comprise

components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means. Individual components may also be provided in a kit in concentrated amounts; in some embodiments, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as Ix, 2x, 5x, 1Ox, or 2Ox or more. Kits for using probes, synthetic nucleic acids, recombinant nucleic acids, or non-synthetic nucleic acids of the invention for therapeutic, prognostic, or diagnostic applications are included as part of the invention. Specifically contemplated are any such molecules corresponding to any miRNA reported to influence biological activity or expression of one or more marker gene or gene pathway described herein. In certain aspects, negative and/or positive controls are included in some kit embodiments. The control molecules can be used to verify transfection efficiency and/or control for transfection-induced changes in cells.

[0069] Certain embodiments are directed to a kit for assessment of a pathological condition or the risk of developing a pathological condition in a patient by nucleic acid profiling of a sample comprising, in suitable container means, two or more nucleic acid hybridization or amplification reagents. The kit can comprise reagents for labeling nucleic acids in a sample and/or nucleic acid hybridization reagents. The hybridization reagents typically comprise hybridization probes. Amplification reagents include, but are not limited to amplification primers, reagents, and enzymes.

[0070] In some embodiments of the invention, an expression profile is generated by steps that include: (a) labeling nucleic acid in the sample; (b) hybridizing the nucleic acid to a number of probes, or amplifying a number of nucleic acids, and (c) determining and/or quantitating nucleic acid hybridization to the probes or detecting and quantitating amplification products, wherein an expression profile is generated. See U.S. Provisional Patent Application 60/575,743 and the U.S. Provisional Patent Application 60/649,584, and U.S. Patent Application Serial No. 11/141,707 and U.S. Patent Application Serial No. 11/273,640, all of which are hereby incorporated by reference.

[0071] Methods of the invention involve diagnosing and/or assessing the prognosis of a patient based on a miRNA and/or a marker nucleic acid expression profile. In certain embodiments, the elevation or reduction in the level of expression of a particular gene or genetic pathway or set of nucleic acids in a cell is correlated with a disease state or pathological condition compared to the expression level of the same in a normal or non-

pathologic cell or tissue sample. This correlation allows for diagnostic and/or prognostic methods to be carried out when the expression level of one or more nucleic acid is measured in a biological sample being assessed and then compared to the expression level of a normal or non-pathologic cell or tissue sample. It is specifically contemplated that expression profiles for patients, particularly those suspected of having or having a propensity for a particular disease or condition such as cancer, can be generated by evaluating any of or sets of the miRNAs and/or nucleic acids discussed in this application. The expression profile that is generated from the patient will be one that provides information regarding the particular disease or condition. In many embodiments, the profile is generated using nucleic acid hybridization or amplification, (e.g., array hybridization or RT-PCR). In certain aspects, an expression profile can be used in conjunction with other diagnostic and/or prognostic tests, such as histology, protein profiles in the serum and/or cytogenetic assessment.

[0072] The methods can further comprise one or more of the steps including: (a) obtaining a sample from the patient, (b) isolating nucleic acids from the sample, (c) labeling the nucleic acids isolated from the sample, and (d) hybridizing the labeled nucleic acids to one or more probes. Nucleic acids of the invention include one or more nucleic acid comprising at least one segment having a sequence or complementary sequence of to a nucleic acid representative of one or more of genes or markers in Table 1, 3, 4, and/or 5.

[0073] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. It is specifically contemplated that any methods and compositions discussed herein with respect to miRNA molecules, miRNA, genes and nucleic acids representative of genes may be implemented with respect to synthetic nucleic acids. In some embodiments the synthetic nucleic acid is exposed to the proper conditions to allow it to become a processed or mature nucleic acid, such as a miRNA under physiological circumstances. The claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims.

[0074] Also, any embodiment of the invention involving specific genes (including representative fragments there of), mRNA, or miRNAs by name is contemplated also to cover embodiments involving miRNAs whose sequences are at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to the mature sequence of the specified miRNA.

[0075] It will be further understood that shorthand notations are employed such that a generic description of a gene or marker thereof, or of a miRNA refers to any of its gene family members (distinguished by a number) or representative fragments thereof, unless otherwise indicated. It is understood by those of skill in the art that a "gene family" refers to a group of genes having the same coding sequence or miRNA coding sequence. Typically, miRNA members of a gene family are identified by a number following the initial designation. For example, miR-16-1 and miR-16-2 are members of the miR-16 gene family and "mir-7" refers to miR-7-1, miR-7-2 and miR-7-3. Moreover, unless otherwise indicated, a shorthand notation refers to related miRNAs (distinguished by a letter). Exceptions to these shorthand notations will be otherwise identified.

[0076] Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well and vice versa. The embodiments in the Example and Detailed Description section are understood to be embodiments of the invention that are applicable to all aspects of the invention.

[0077] The terms "inhibiting," "reducing," or "prevention," or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result.

[0078] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

[0079] Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0080] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or."

[0081] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and

"include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0082] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

DESCRIPTION OF THE DRAWINGS

[0083] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0084] FIG. 1. Percent (%) proliferation of eight human lung cancer cell lines treated with hsa-miPv-34a and other compounds, relative to cells treated with negative control miRNA (100%). Abbreviations: miR-34a, hsa-miR-34a; siEg5, siRNA against the motor protein kinesin 11 (Eg5); Etopo, etoposide; NC, negative control miRNA. Standard deviations are indicated in the graph.

[0085] FIG. 2. Long-term effects of hsa-miR-34a on cultured human H226 lung cancer cell numbers. Equal numbers of H226 cells were electroporated with 1.6 μM hsa-miR-34a (white squares) or negative control miRNA (NC, black diamonds), seeded and propagated in regular growth medium. When the control cells reached confluence (days 6, 17 and 25), cells were harvested, counted and electroporated again with the respective miRNAs. The population doubling and cumulative cell counts was calculated and plotted on a linear scale. Arrows represent electroporation days. Abbreviation: miR-34a, hsa-miR-34a; NC, negative control miRNA.

[0086] FIG. 3. Percent (%) proliferation of H460 lung cancer cells following administration of various combinations of microRNAs. A positive sign under each bar in the graph indicates that the miRNA was present in the administered combination. Standard deviations are shown in the graph. Abbreviations: miR-34a, hsa-miR-34a; miR-124a, hsa-

miR-124a; miR-126, hsa-miR-126; miR-147, hsa-miR-147; let-7b, hsa-let-7b; let-7c, hsa-let- 7c; let-7g, hsa-let-7g; Etopo, etoposide; NC, negative control miRNA.

[0087] FIG. 4. Average tumor volumes in groups of six (n=6) mice carrying human H460 lung cancer xenografts. Palpable tumors were treated with hsa-miR-34a (white squares) or with a negative control miRNA (NC, black diamonds) on days 11, 14, and 17 (arrows). Standard deviations are shown in the graph. Data points with p values <0.1, <0.05 and <0.01 are indicated by a cross, an asterisk or circles, respectively. Abbreviation: miR- 34a, hsa-miR-34a; NC, negative control miRNA.

[0088] FIG. 5. Percent (%) proliferation of hsa-miR-34a treated human prostate cancer cells relative to cells treated with negative control miRNA (100%). Abbreviations: miR-34a, hsa-miR-34a; siEg5, siRNA against the motor protein kinesin 11 (Eg5); NC, negative control miRNA. Standard deviations are indicated in the graph.

[0089] FIG. 6. Long-term effects of hsa-miR-34a on cultured human PPC-I, PC3 and Dul45 prostate cancer cells. Equal numbers cells were electroporated with 1.6 μM hsa-miR- 34a (white squares) or negative control miRNA (NC, black diamonds), seeded and propagated in regular growth medium. When the control cells reached confluence (days 4 and 11 for PPC-I, days 7 and 14 for PC3 and DuI 45), cells were harvested, counted and electroporated again with the respective miRNAs. The population doubling and cumulative cell counts was calculated and plotted on a linear scale. Arrows represent electroporation days. Experiments with PC3 and Dul45 cells were carried out in triplicates. Standard deviations are shown in the graphs. Abbreviation: miR-34a, hsa-miR-34a; NC, negative control miRNA.

[0090] FIG. 7. Average tumor volumes in groups of seven (n=7) mice carrying human PPC-I prostate cancer xenografts. Human PPC-I prostate tumor cells were treated with hsa- miR-34a (white squares) or with a negative control miRNA (NC, black diamonds) on days 0, 7, 13, 20, and 25 (arrows). Tumor growth was determined by caliper measurements for 32 days. Standard deviations are shown in the graph. All data points yielded p values <0.01. The p value obtained from data on day 22 is indicated by a circle. Abbreviation: miR-34a, hsa-miR-34a; NC, negative control miRNA.

[0091] FIG. 8. Histology of tumors that developed from PPC-I prostate cancer cells treated with negative control miRNA (right) or hsa-miR-34a (left). Images show tumors

stained with hematoxylin and eosin. The arrow indicates a pocket with seemingly viable cells. Abbreviation: miR-34a, hsa-miR-34a; NC, negative control miRNA.

[0092] FIG. 9. Immunohistochemistry of PPC-I tumors treated with negative control miRNA (top panels) or hsa-miR-34a (bottom panels). For hsa-miR-34a-treated tumors, the analysis is limited to areas with seemingly viable cells as shown in FIG. 8. Left images show tumor cells stained with hematoxylin and eosin (H&E); center images show an immunohistochemistry analysis using antibodies against the Ki-67 antigen (dark spotted areas); right images show an immunohistochemistry analysis using antibodies against caspase 3. Areas with increased apoptotic activity are exemplarily denoted by arrows. Abbreviation: miR-34a, hsa-miR-34a; NC, negative control miRNA.

DETAILED DESCRIPTION OF THE INVENTION

[0093] The present invention is directed to compositions and methods relating to the identification and characterization of genes and biological pathways related to these genes as represented by the expression of the identified genes, as well as use of miRNAs related to such, for therapeutic, prognostic, and diagnostic applications, particularly those methods and compositions related to assessing and/or identifying pathological conditions directly or indirectly related to miR-34 expression or the aberrant expression thereof.

[0094] In certain aspects, the invention is directed to methods for the assessment, analysis, and/or therapy of a cell or subject where certain genes have a reduced or increased expression (relative to normal) as a result of an increased or decreased expression of any one or a combination of miR-34 family members (including, but not limited to SEQ ID NO:1 to SEQ ID NO:71) and/or genes with an increased expression (relative to normal) as a result of an increased or decreased expression of one or a combination of miR-34 family members. The expression profile and/or response to miR-34 expression or inhibition may be indicative of a disease or an individual with a condition, e.g., cancer.

[0095] Prognostic assays featuring any one or combination of the miRNAs listed or the markers listed (including nucleic acids representative thereof) could be used in assessment of a patient to determine what if any treatment regimen is justified. As with the diagnostic assays mentioned above, the absolute values that define low expression will depend on the platform used to measure the miRNA(s). The same methods described for the diagnostic assays could be used for prognostic assays.

I. THERAPEUTIC METHODS

[0096] Embodiments of the invention concern nucleic acids that perform the activities of or inhibit endogenous miRNAs when introduced into cells. In certain aspects, nucleic acids are synthetic or non-synthetic miRNA. Sequence-specific miRNA inhibitors can be used to inhibit sequentially or in combination the activities of one or more endogenous miRNAs in cells, as well those genes and associated pathways modulated by the endogenous miRNA.

[0097] The present invention concerns, in some embodiments, short nucleic acid molecules that function as miRNAs or as inhibitors of miRNA in a cell. The term "short" refers to a length of a single polynucleotide that is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 100, or 150 nucleotides or fewer, including all integers or ranges derivable there between. The nucleic acid molecules are typically synthetic. The term "synthetic" refers to nucleic acid molecule that is isolated and not produced naturally in a cell. In certain aspects the sequence (the entire sequence) and/or chemical structure deviates from a naturally-occurring nucleic acid molecule, such as an endogenous precursor miRNA or miRNA molecule or complement thereof. While in some embodiments, nucleic acids of the invention do not have an entire sequence that is identical or complementary to a sequence of a naturally-occurring nucleic acid, such molecules may encompass all or part of a naturally-occurring sequence or a complement thereof. It is contemplated, however, that a synthetic nucleic acid administered to a cell may subsequently be modified or altered in the cell such that its structure or sequence is the same as non-synthetic or naturally occurring nucleic acid, such as a mature miRNA sequence. For example, a synthetic nucleic acid may have a sequence that differs from the sequence of a precursor miRNA, but that sequence may be altered once in a cell to be the same as an endogenous, processed miRNA or an inhibitor thereof. The term "isolated" means that the nucleic acid molecules of the invention are initially separated from different (in terms of sequence or structure) and unwanted nucleic acid molecules such that a population of isolated nucleic acids is at least about 90% homogenous, and may be at least about 95, 96, 97, 98, 99, or 100% homogenous with respect to other polynucleotide molecules. In many embodiments of the invention, a nucleic acid is isolated by virtue of it having been synthesized in vitro separate from endogenous nucleic acids in a cell. It will be understood, however, that isolated nucleic acids may be subsequently mixed or pooled together. In certain aspects, synthetic miRNA of the invention are RNA or RNA analogs. miRNA inhibitors may be DNA or RNA, or analogs thereof. miRNA and miRNA inhibitors of the invention are collectively referred to as "synthetic nucleic acids."

[0098] In some embodiments, there is a miRNA or a synthetic miRNA having a length of between 17 and 130 residues. The present invention concerns miRNA or synthetic miRNA molecules that are, are at least, or are at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 145, 150, 160, 170, 180, 190, 200 or more residues in length, including any integer or any range there between.

[0099] In certain embodiments, synthetic miRNA have (a) a "miRNA region" whose sequence or binding region from 5 ' to 3 ' is identical or complementary to all or a segment of a mature miRNA sequence, and (b) a "complementary region" whose sequence from 5' to 3' is between 60% and 100% complementary to the miRNA sequence in (a). In certain embodiments, these synthetic miRNA are also isolated, as defined above. The term "miRNA region" refers to a region on the synthetic miRNA that is at least 75, 80, 85, 90, 95, or 100% identical, including all integers there between, to the entire sequence of a mature, naturally occurring miRNA sequence or a complement thereof. In certain embodiments, the miRNA region is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% identical to the sequence of a naturally-occurring miRNA or complement thereof.

[00100] The term "complementary region" or "complement" refers to a region of a nucleic acid or mimetic that is or is at least 60% complementary to the mature, naturally occurring miRNA sequence. The complementary region is or is at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein. With single polynucleotide sequences, there may be a hairpin loop structure as a result of chemical bonding between the miRNA region and the complementary region. In other embodiments, the complementary region is on a different nucleic acid molecule than the miRNA region, in which case the complementary region is on the complementary strand and the miRNA region is on the active strand.

[00101] In other embodiments of the invention, there are synthetic nucleic acids that are miRNA inhibitors. A miRNA inhibitor is between about 17 to 25 nucleotides in length and

comprises a 5 ' to 3 ' sequence that is at least 90% complementary to the 5 ' to 3 ' sequence of a mature miRNA. In certain embodiments, a miRNA inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. Moreover, an miRNA inhibitor may have a sequence (from 5' to 3') that is or is at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein, to the 5' to 3' sequence of a mature miRNA, particularly a mature, naturally occurring miRNA. One of skill in the art could use a portion of the miRNA sequence that is complementary to the sequence of a mature miRNA as the sequence for a miRNA inhibitor. Moreover, that portion of the nucleic acid sequence can be altered so that it is still comprises the appropriate percentage of complementarity to the sequence of a mature miRNA.

[00102] In some embodiments, of the invention, a synthetic miRNA or inhibitor contains one or more design element(s). These design elements include, but are not limited to: (i) a replacement group for the phosphate or hydroxyl of the nucleotide at the 5 ' terminus of the complementary region; (ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, (iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3 ' end of the complementary region and the corresponding nucleotides of the miRNA region. A variety of design modifications are known in the art, see below.

[00103] In certain embodiments, a synthetic miRNA has a nucleotide at its 5' end of the complementary region in which the phosphate and/or hydroxyl group has been replaced with another chemical group (referred to as the "replacement design"). In some cases, the phosphate group is replaced, while in others, the hydroxyl group has been replaced. In particular embodiments, the replacement group is biotin, an amine group, a lower alkylamine group, an aminohexyl phosphate group, an acetyl group, 2 O-Me (2 Oxygen-methyl), DMTO (4,4'-dimethoxytrityl with oxygen), fluorescein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well. This design element can also be used with a miRNA inhibitor.

[00104] Additional embodiments concern a synthetic miRNA having one or more sugar modifications in the first or last 1 to 6 residues of the complementary region (referred to as the "sugar replacement design"). In certain cases, there is one or more sugar modifications in the first 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable

therein. In additional cases, there are one or more sugar modifications in the last 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein, have a sugar modification. It will be understood that the terms "first" and "last" are with respect to the order of residues from the 5' end to the 3' end of the region. In particular embodiments, the sugar modification is a 2'0-Me modification, a 2'F modification, a 2'H modification, a 2 'amino modification, a 4'thioribose modification or a phosphorothioate modification on the carboxy group linked to the carbon at position 6'. In further embodiments, there are one or more sugar modifications in the first or last 2 to 4 residues of the complementary region or the first or last 4 to 6 residues of the complementary region. This design element can also be used with a miRNA inhibitor. Thus, a miRNA inhibitor can have this design element and/or a replacement group on the nucleotide at the 5' terminus, as discussed above.

[00105] In other embodiments of the invention, there is a synthetic miRNA or inhibitor in which one or more nucleotides in the last 1 to 5 residues at the 3 ' end of the complementary region are not complementary to the corresponding nucleotides of the miRNA region ("noncomplementarity") (referred to as the "noncomplementarity design"). The noncomplementarity may be in the last 1, 2, 3, 4, and/or 5 residues of the complementary miRNA. In certain embodiments, there is noncomplementarity with at least 2 nucleotides in the complementary region.

[00106] It is contemplated that synthetic miRNA of the invention have one or more of the replacement, sugar modification, or noncomplementarity designs. In certain cases, synthetic RNA molecules have two of them, while in others these molecules have all three designs in place.

[00107] The miRNA region and the complementary region may be on the same or separate polynucleotides. In cases in which they are contained on or in the same polynucleotide, the miRNA molecule will be considered a single polynucleotide. In embodiments in which the different regions are on separate polynucleotides, the synthetic miRNA will be considered to be comprised of two polynucleotides.

[00108] When the RNA molecule is a single polynucleotide, there can be a linker region between the miRNA region and the complementary region. In some embodiments, the single polynucleotide is capable of forming a hairpin loop structure as a result of bonding between the miRNA region and the complementary region. The linker constitutes the hairpin loop. It

is contemplated that in some embodiments, the linker region is, is at least, or is at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in length, or any range derivable therein. In certain embodiments, the linker is between 3 and 30 residues (inclusive) in length.

[00109] In addition to having a miRNA or inhibitor region and a complementary region, there may be flanking sequences as well at either the 5 ' or 3 ' end of the region. In some embodiments, there is or is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides or more, or any range derivable therein, flanking one or both sides of these regions.

[00110] Methods of the invention include reducing or eliminating activity of one or more miRNAs in a cell comprising introducing into a cell a miRNA inhibitor (which may be described generally herein as an miRNA, so that a description of miRNA, where appropriate, also will refer to a miRNA inhibitor); or supplying or enhancing the activity of one or more miRNAs in a cell. The present invention also concerns inducing certain cellular characteristics by providing to a cell a particular nucleic acid, such as a specific synthetic miRNA molecule or a synthetic miRNA inhibitor molecule. However, in methods of the invention, the miRNA molecule or miRNA inhibitor need not be synthetic. They may have a sequence that is identical to a naturally occurring miRNA or they may not have any design modifications. In certain embodiments, the miRNA molecule and/or the miRNA inhibitor are synthetic, as discussed above.

[00111] The particular nucleic acid molecule provided to the cell is understood to correspond to a particular miRNA in the cell, and thus, the miRNA in the cell is referred to as the "corresponding miRNA." In situations in which a named miRNA molecule is introduced into a cell, the corresponding miRNA will be understood to be the induced or inhibited miRNA function. It is contemplated, however, that the miRNA molecule introduced into a cell is not a mature miRNA but is capable of becoming or functioning as a mature miRNA under the appropriate physiological conditions. In cases in which a particular corresponding miRNA is being inhibited by a miRNA inhibitor, the particular miRNA will be referred to as the "targeted miRNA." It is contemplated that multiple corresponding miRNAs may be involved. In particular embodiments, more than one miRNA molecule is introduced into a cell. Moreover, in other embodiments, more than one miRNA inhibitor is introduced into a cell. Furthermore, a combination of miRNA molecule(s) and miRNA inhibitor(s) may be introduced into a cell. The inventors contemplate that a combination of miRNA may act at

one or more points in cellular pathways of cells with aberrant phenotypes and that such combination may have increased efficacy on the target cell while not adversely effecting normal cells. Thus, a combination of miRNA may have a minimal adverse effect on a subject or patient while supplying a sufficient therapeutic effect, such as amelioration of a condition, growth inhibition of a cell, death of a targeted cell, alteration of cell phenotype or physiology, slowing of cellular growth, sensitization to a second therapy, sensitization to a particular therapy, and the like.

[00112] Methods include identifying a cell or patient in need of inducing those cellular characteristics. Also, it will be understood that an amount of a synthetic nucleic acid that is provided to a cell or organism is an "effective amount," which refers to an amount needed (or a sufficient amount) to achieve a desired goal, such as inducing a particular cellular characteristic(s).

[00113] In certain embodiments of the methods include providing or introducing to a cell a nucleic acid molecule corresponding to a mature miRNA in the cell in an amount effective to achieve a desired physiological result.

[00114] Moreover, methods can involve providing synthetic or nonsynthetic miRNA molecules. It is contemplated that in these embodiments, that methods may or may not be limited to providing only one or more synthetic miRNA molecules or only one or more nonsynthetic miRNA molecules. Thus, in certain embodiments, methods may involve providing both synthetic and nonsynthetic miRNA molecules. In this situation, a cell or cells are most likely provided a synthetic miRNA molecule corresponding to a particular miRNA and a nonsynthetic miRNA molecule corresponding to a different miRNA. Furthermore, any method articulated using a list of miRNAs using Markush group language may be articulated without the Markush group language and a disjunctive article (i.e., or) instead, and vice versa.

[00115] In some embodiments, there is a method for reducing or inhibiting cell proliferation in a cell comprising introducing into or providing to the cell an effective amount of (i) an miRNA inhibitor molecule or (ii) a synthetic or nonsynthetic miRNA molecule that corresponds to a miRNA sequence. In certain embodiments the methods involves introducing into the cell an effective amount of (i) a miRNA inhibitor molecule having a 5 ' to 3' sequence that is at least 90% complementary to the 5' to 3' sequence of one or more mature miRNA.

[00116] Certain embodiments of the invention include methods of treating a pathologic condition, in particular cancer, e.g. , lung or liver cancer. In one aspect, the method comprises contacting a target cell with one or more nucleic acid, synthetic miRNA, or miRNA comprising at least one nucleic acid segment having all or a portion of a miRNA sequence. The segment may be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides or nucleotide analog, including all integers there between. An aspect of the invention includes the modulation of gene expression, miRNA expression or function or mRNA expression or function within a target cell, such as a cancer cell.

[00117] Typically, an endogenous gene, miRNA or mRNA is modulated in the cell. In particular embodiments, the nucleic acid sequence comprises at least one segment that is at least 70, 75, 80, 85, 90, 95, or 100% identical in nucleic acid sequence to one or more miRNA or gene sequence. Modulation of the expression or processing of an endogenous gene, miRNA, or mRNA can be through modulation of the processing of a mRNA, such processing including transcription, transportation and/or translation with in a cell. Modulation may also be effected by the inhibition or enhancement of miRNA activity with a cell, tissue, or organ. Such processing may affect the expression of an encoded product or the stability of the mRNA. In still other embodiments, a nucleic acid sequence can comprise a modified nucleic acid sequence. In certain aspects, one or more miRNA sequence may include or comprise a modified nucleobase or nucleic acid sequence.

[00118] It will be understood in methods of the invention that a cell or other biological matter such as an organism (including patients) can be provided a miRNA or miRNA molecule corresponding to a particular miRNA by administering to the cell or organism a nucleic acid molecule that functions as the corresponding miRNA once inside the cell. The form of the molecule provided to the cell may not be the form that acts a miRNA once inside the cell. Thus, it is contemplated that in some embodiments, a synthetic miRNA or a nonsynthetic miRNA is provided such that it becomes processed into a mature and active miRNA once it has access to the cell's miRNA processing machinery. In certain embodiments, it is specifically contemplated that the miRNA molecule provided is not a mature miRNA molecule but a nucleic acid molecule that can be processed into the mature miRNA once it is accessible to miRNA processing machinery. The term "nonsynthetic" in the context of miRNA means that the miRNA is not "synthetic," as defined herein. Furthermore, it is contemplated that in embodiments of the invention that concern the use of

synthetic miRNAs, the use of corresponding nonsynthetic miRNAs is also considered an aspect of the invention, and vice versa. It will be understand that the term "providing" an agent is used to include "administering" the agent to a patient.

[00119] In certain embodiments, methods also include targeting a miRNA to modulate in a cell or organism. The term "targeting a miRNA to modulate" means a nucleic acid of the invention will be employed so as to modulate the selected miRNA. In some embodiments the modulation is achieved with a synthetic or non-synthetic miRNA that corresponds to the targeted miRNA, which effectively provides the targeted miRNA to the cell or organism (positive modulation). In other embodiments, the modulation is achieved with a miRNA inhibitor, which effectively inhibits the targeted miRNA in the cell or organism (negative modulation).

[00120] In some embodiments, the miRNA targeted to be modulated is a miRNA that affects a disease, condition, or pathway. In certain embodiments, the miRNA is targeted because a treatment can be provided by negative modulation of the targeted miRNA. In other embodiments, the miRNA is targeted because a treatment can be provided by positive modulation of the targeted miRNA or its targets..

[00121] In certain methods of the invention, there is a further step of administering the selected miRNA modulator to a cell, tissue, organ, or organism (collectively "biological matter") in need of treatment related to modulation of the targeted miRNA or in need of the physiological or biological results discussed herein (such as with respect to a particular cellular pathway or result like decrease in cell viability). Consequently, in some methods of the invention there is a step of identifying a patient in need of treatment that can be provided by the miRNA modulator(s). It is contemplated that an effective amount of a miRNA modulator can be administered in some embodiments. In particular embodiments, there is a therapeutic benefit conferred on the biological matter, where a "therapeutic benefit" refers to an improvement in the one or more conditions or symptoms associated with a disease or condition or an improvement in the prognosis, duration, or status with respect to the disease. It is contemplated that a therapeutic benefit includes, but is not limited to, a decrease in pain, a decrease in morbidity, a decrease in a symptom. For example, with respect to cancer, it is contemplated that a therapeutic benefit can be inhibition of tumor growth, prevention of metastasis, reduction in number of metastases, inhibition of cancer cell proliferation, induction of cell death in cancer cells, inhibition of angiogenesis near cancer cells, induction

of apoptosis of cancer cells, reduction in pain, reduction in risk of recurrence, induction of chemo- or radiosensitivity in cancer cells, prolongation of life, and/or delay of death directly or indirectly related to cancer.

[00122] Furthermore, it is contemplated that the miRNA compositions may be provided as part of a therapy to a patient, in conjunction with traditional therapies or preventative agents. Moreover, it is contemplated that any method discussed in the context of therapy may be applied as preventatively, particularly in a patient identified to be potentially in need of the therapy or at risk of the condition or disease for which a therapy is needed.

[00123] In addition, methods of the invention concern employing one or more nucleic acids corresponding to a miRNA and a therapeutic drug. The nucleic acid can enhance the effect or efficacy of the drug, reduce any side effects or toxicity, modify its bioavailability, and/or decrease the dosage or frequency needed. In certain embodiments, the therapeutic drug is a cancer therapeutic. Consequently, in some embodiments, there is a method of treating cancer in a patient comprising administering to the patient the cancer therapeutic and an effective amount of at least one miRNA molecule that improves the efficacy of the cancer therapeutic or protects non-cancer cells. Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments. Combination chemotherapies include but are not limited to, for example, 5-fluorouracil, alemtuzumab, amrubicin, bevacizumab, bleomycin, bortezomib, busulfan, camptothecin, capecitabine, cisplatin (CDDP), carboplatin, cetuximab, chlorambucil, cisplatin (CDDP), cyclophosphamide, camptothecin, COX-2 inhibitors (e.g., celecoxib), cyclophosphamide, cytarabine, dactinomycin, dasatinib, daunorubicin, dexamethasone, docetaxel, doxorubicin (adriamycin), EGFR inhibitors (gefitinib and cetuximab), erlotinib, estrogen receptor binding agents, etoposide (VP 16), everolimus, farnesyl -protein transferase inhibitors, gefitinib, gemcitabine, gemtuzumab, ibritumomab, ifosfamide, imatinib mesylate, larotaxel, lapatinib, lonafarnib, mechlorethamine, melphalan, methotrexate, mitomycin, navelbine, nitrosurea, nocodazole, oxaliplatin, paclitaxel, plicomycin, procarbazine, raloxifene, rituximab, sirolimus, sorafenib, sunitinib, tamoxifen, taxol, taxotere, temsirolimus, tipifarnib, tositumomab, transplatinum, trastuzumab, vinblastin, vincristin, or vinorelbine or any analog or derivative variant of the foregoing.

[00124] Generally, inhibitors of miRNAs can be given to decrease the activity of an endogenous miRNA. Similarly, nucleic acid molecules corresponding to the mature miRNA

can be given to achieve the opposite effect as compared to when inhibitors of the miRNA are given. For example, inhibitors of miRNA molecules that increase cell proliferation can be provided to cells to increase proliferation or decrease cell proliferation. The present invention contemplates these embodiments in the context of the different physiological effects observed with the different miRNA molecules and miRNA inhibitors disclosed herein. These include, but are not limited to, the following physiological effects: increase and decreasing cell proliferation, increasing or decreasing apoptosis, increasing transformation, increasing or decreasing cell viability, activating or inhibiting a kinase (e.g., Erk), activating/inducing or inhibiting hTert, inhibit stimulation of growth promoting pathway (e.g., Stat 3 signaling), reduce or increase viable cell number, and increase or decrease number of cells at a particular phase of the cell cycle. Methods of the invention are generally contemplated to include providing or introducing one or more different nucleic acid molecules corresponding to one or more different miRNA molecules. It is contemplated that the following, at least the following, or at most the following number of different nucleic acid or miRNA molecules may be provided or introduced: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or any range derivable therein. This also applies to the number of different miRNA molecules that can be provided or introduced into a cell.

II. PHARMACEUTICAL FORMULATIONS AND DELIVERY

[00125] Methods of the present invention include the delivery of an effective amount of a miRNA or an expression construct encoding the same. An "effective amount" of the pharmaceutical composition, generally, is defined as that amount sufficient to detectably and repeatedly to achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms. Other more rigorous definitions may apply, including elimination, eradication or cure of disease.

A. Administration

[00126] In certain embodiments, it is desired to kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size, and/or reverse or reduce the malignant or disease phenotype of cells. The routes of administration will vary, naturally, with the location and

nature of the lesion or site to be targeted, and include, e.g., intradermal, subcutaneous, regional, parenteral, intravenous, intramuscular, intranasal, systemic, and oral administration and formulation. Direct injection, intratumoral injection, or injection into tumor vasculature is specifically contemplated for discrete, solid, accessible tumors, or other accessible target areas. Local, regional, or systemic administration also may be appropriate. For tumors of >4 cm, the volume to be administered will be about 4-10 ml (preferably 10 ml), while for tumors of <4 cm, a volume of about 1-3 ml will be used (preferably 3 ml).

[00127] Multiple injections delivered as a single dose comprise about 0.1 to about 0.5 ml volumes. Compositions of the invention may be administered in multiple injections to a tumor or a targeted site. In certain aspects, injections may be spaced at approximately 1 cm intervals.

[00128] In the case of surgical intervention, the present invention may be used preoperatively, to render an inoperable tumor subject to resection. Alternatively, the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising a miRNA or combinations thereof. Administration may be continued post- resection, for example, by leaving a catheter implanted at the site of the surgery. Periodic post-surgical treatment also is envisioned. Continuous perfusion of an expression construct or a viral construct also is contemplated.

[00129] Continuous administration also may be applied where appropriate, for example, where a tumor or other undesired affected area is excised and the tumor bed or targeted site is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is contemplated. Such continuous perfusion may take place for a period from about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs.

[00130] Treatment regimens may vary as well and often depend on tumor type, tumor location, immune condition, target site, disease progression, and health and age of the patient. Certain tumor types will require more aggressive treatment. The clinician will be best suited

to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations.

[00131] In certain embodiments, the tumor or affected area being treated may not, at least initially, be resectable. Treatments with compositions of the invention may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection may serve to eliminate microscopic residual disease at the tumor or targeted site.

[00132] Treatments may include various "unit doses." A unit dose is defined as containing a predetermined quantity of a therapeutic composition(s). The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. With respect to a viral component of the present invention, a unit dose may conveniently be described in terms of μg or mg of miRNA or miRNA mimetic. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose.

[00133] miRNA can be administered to the patient in a dose or doses of about or of at least about 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 μg or mg, or more, or any range derivable therein. Alternatively, the amount specified may be the amount administered as the average daily, average weekly, or average monthly dose, or it may be expressed in terms of mg/kg, where kg refers to the weight of the patient and the mg is specified above. In other embodiments, the amount specified is any number discussed above but expressed as mg/m (with respect to tumor size or patient surface area).

B. Injectable Compositions and Formulations

[00134] In some embodiments, the method for the delivery of a miRNA or an expression construct encoding such or combinations thereof is via systemic administration. However,

the pharmaceutical compositions disclosed herein may also be administered parenterally, subcutaneously, directly, intratracheally, intravenously, intradermally, intramuscularly, or even intraperitoneally as described in U.S. Patents 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety).

[00135] Injection of nucleic acids may be delivered by syringe or any other method used for injection of a solution, as long as the nucleic acid and any associated components can pass through the particular gauge of needle required for injection. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Patent 5,846,225).

[00136] Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[00137] In certain formulations, a water-based formulation is employed while in others, it may be lipid-based. In particular embodiments of the invention, a composition comprising a tumor suppressor protein or a nucleic acid encoding the same is in a water-based formulation. In other embodiments, the formulation is lipid based.

[00138] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral, intralesional, and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.

[00139] As used herein, a "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[00140] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.

[00141] The nucleic acid(s) are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective. The quantity to be administered depends on the subject to be treated, including, e.g., the aggressiveness of the

disease or cancer, the size of any tumor(s) or lesions, the previous or other courses of treatment. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner. Suitable regimes for initial administration and subsequent administration are also variable, but are typified by an initial administration followed by other administrations. Such administration may be systemic, as a single dose, continuous over a period of time spanning 10, 20, 30, 40, 50, 60 minutes, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more hours, and/or 1, 2, 3, 4, 5, 6, 7, days or more. Moreover, administration may be through a time release or sustained release mechanism, implemented by formulation and/or mode of administration.

[00142] Various methods for nucleic acid delivery are described, for example in Sambrook et al, 1989 and Ausubel et ah, 1994. Such nucleic acid delivery systems comprise the desired nucleic acid, by way of example and not by limitation, in either "naked" form as a "naked" nucleic acid, or formulated in a vehicle suitable for delivery, such as in a complex with a cationic molecule or a liposome forming lipid, or as a component of a vector, or a component of a pharmaceutical composition. The nucleic acid delivery system can be provided to the cell either directly, such as by contacting it with the cell, or indirectly, such as through the action of any biological process. By way of example, and not by limitation, the nucleic acid delivery system can be provided to the cell by endocytosis; receptor targeting; coupling with native or synthetic cell membrane fragments; physical means such as electroporation; combining the nucleic acid delivery system with a polymeric carrier, such as a controlled release film or nanoparticle or microparticle or biocompatible molecules or biodegradable molecules; with vector. The nucleic acid delivery system can be injected into a tissue or fluid surrounding the cell, or administered by diffusion of the nucleic acid delivery system across the cell membrane, or by any active or passive transport mechanism across the cell membrane. Additionally, the nucleic acid delivery system can be provided to the cell using techniques such as antibody-related targeting and antibody-mediated immobilization of a viral vector.

C. Combination Treatments

[00143] In certain embodiments, the compositions and methods of the present invention involve a miRNA, or expression construct encoding such. These miRNA composition can be used in combination with a second therapy to enhance the effect of the miRNA therapy, or increase the therapeutic effect of another therapy being employed. These compositions

would be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with the miRNA or second therapy at the same or different time. This may be achieved by contacting the cell with one or more compositions or pharmacological formulation that includes or more of the agents, or by contacting the cell with two or more distinct compositions or formulations, wherein one composition provides (1) miRNA; and/or (2) a second therapy. A second composition or method may be administered that includes a chemotherapy, radiotherapy, surgical therapy, immunotherapy or gene therapy.

[00144] It is contemplated that one may provide a patient with the miRNA therapy and the second therapy within about 12-24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.

[00145] In certain embodiments, a course of treatment will last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 days or more. It is contemplated that one agent may be given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, any combination thereof, and another agent is given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no treatment is administered. This time period may last 1 , 2, 3, 4, 5, 6, 7 days, and/or 1, 2, 3, 4, 5 weeks, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12

months or more, depending on the condition of the patient, such as their prognosis, strength, health, etc.

[00146] Various combinations may be employed, for example miRNA therapy is "A" and a second therapy is "B":

[00147] A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B

[00148] B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A

[00149] B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A

[00150] Administration of any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the vector or any protein or other agent. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy.

[00151] In specific aspects, it is contemplated that a second therapy, such as chemotherapy, radiotherapy, immunotherapy, surgical therapy or other gene therapy, is employed in combination with the miRNA therapy, as described herein.

1. Chemotherapy

[00152] A wide variety of chemotherapeutic agents may be used in accordance with the present invention. The term "chemotherapy" refers to the use of drugs to treat cancer. A "chemotherapeutic agent" is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.

a. Alkylating agents

[00153] Alkylating agents are drugs that directly interact with genomic DNA to prevent the cancer cell from proliferating. This category of chemotherapeutic drugs represents agents that affect all phases of the cell cycle, that is, they are not phase-specific. Alkylating agents can be implemented to treat chronic leukemia, non-Hodgkin's lymphoma, Hodgkin's disease, multiple myeloma, and particular cancers of the breast, lung, and ovary. They include: busulfan, chlorambucil, cisplatin, cyclophosphamide (Cytoxan), dacarbazine, ifosfamide, mechlorethamine (mustargen), and melphalan. Troglitazaone can be used to treat cancer in combination with any one or more of these alkylating agents.

b. Antimetabolites

[00154] Antimetabolites disrupt DNA and RNA synthesis. Unlike alkylating agents, they specifically influence the cell cycle during S phase. They have been used to combat chronic leukemias in addition to tumors of breast, ovary and the gastrointestinal tract. Antimetabolites include 5-fluorouracil (5-FU), cytarabine (Ara-C), fludarabine, gemcitabine, and methotrexate.

[00155] 5-Fluorouracil (5-FU) has the chemical name of 5-fiuoro-2,4(lH,3H)- pyrimidinedione. Its mechanism of action is thought to be by blocking the methylation reaction of deoxyuridylic acid to thymidylic acid. Thus, 5 -FU interferes with the synthesis of deoxyribonucleic acid (DNA) and to a lesser extent inhibits the formation of ribonucleic acid (RNA). Since DNA and RNA are essential for cell division and proliferation, it is thought that the effect of 5 -FU is to create a thymidine deficiency leading to cell death. Thus, the effect of 5-FU is found in cells that rapidly divide, a characteristic of metastatic cancers.

c. Antitumor Antibiotics

[00156] Antitumor antibiotics have both antimicrobial and cytotoxic activity. These drugs also interfere with DNA by chemically inhibiting enzymes and mitosis or altering cellular membranes. These agents are not phase specific so they work in all phases of the cell cycle. Thus, they are widely used for a variety of cancers. Examples of antitumor antibiotics include bleomycin, dactinomycin, daunorubicin, doxorubicin (Adriamycin), and idarubicin, some of which are discussed in more detail below. Widely used in clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections

intravenously at doses ranging from 25-75 mg/m at 21 day intervals for adriamycin, to 35- 100 mg/m2 for etoposide intravenously or orally.

d. Mitotic Inhibitors

[00157] Mitotic inhibitors include plant alkaloids and other natural agents that can inhibit either protein synthesis required for cell division or mitosis. They operate during a specific phase during the cell cycle. Mitotic inhibitors comprise docetaxel, etoposide (VP 16), paclitaxel, taxol, taxotere, vinblastine, vincristine, and vinorelbine.

e. Nitrosureas

[00158] Nitrosureas, like alkylating agents, inhibit DNA repair proteins. They are used to treat non-Hodgkin's lymphomas, multiple myeloma, malignant melanoma, in addition to brain tumors. Examples include carmustine and lomustine.

2. Radiotherapy

[00159] Radiotherapy, also called radiation therapy, is the treatment of cancer and other diseases with ionizing radiation. Ionizing radiation deposits energy that injures or destroys cells in the area being treated by damaging their genetic material, making it impossible for these cells to continue to grow. Although radiation damages both cancer cells and normal cells, the latter are able to repair themselves and function properly. Radiotherapy may be used to treat localized solid tumors, such as cancers of the skin, tongue, larynx, brain, breast, or cervix. It can also be used to treat leukemia and lymphoma (cancers of the blood-forming cells and lymphatic system, respectively).

[00160] Radiation therapy used according to the present invention may include, but is not limited to, the use of γ-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287) and UV-irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. Radiotherapy may

comprise the use of radiolabeled antibodies to deliver doses of radiation directly to the cancer site (radioimmunotherapy). Once injected into the body, the antibodies actively seek out the cancer cells, which are destroyed by the cell-killing (cytotoxic) action of the radiation. This approach can minimize the risk of radiation damage to healthy cells.

[00161] Stereotactic radio-surgery (gamma knife) for brain and other tumors does not use a knife, but very precisely targeted beams of gamma radiotherapy from hundreds of different angles. Only one session of radiotherapy, taking about four to five hours, is needed. For this treatment a specially made metal frame is attached to the head. Then, several scans and x- rays are carried out to find the precise area where the treatment is needed. During the radiotherapy for brain tumors, the patient lies with their head in a large helmet, which has hundreds of holes in it to allow the radiotherapy beams through. Related approaches permit positioning for the treatment of tumors in other areas of the body.

3. Immunotherapy

[00162] In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Trastuzumab (Herceptin™) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of ErbB2 would provide therapeutic benefit in the treatment of ErbB2 overexpressing cancers.

[00163] In one aspect of immunotherapy, the tumor or disease cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pi 55. An alternative aspect of immunotherapy is to combine anticancer effects with

immune stimulatory effects. Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines such as MIP-I, MCP-I, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor such as MDA-7 has been shown to enhance anti-tumor effects (Ju et al, 2000). Moreover, antibodies against any of these compounds can be used to target the anti-cancer agents discussed herein.

[00164] Examples of immunotherapies currently under investigation or in use are immune adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al, 1998), cytokine therapy e.g., interferons α, β and γ; IL-I, GM-CSF and TNF (Bukowski et al, 1998; Davidson et al, 1998; Hellstrand et al, 1998) gene therapy e.g., TNF, IL-I, IL-2, p53 (Qin et al, 1998; Austin-Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945) and monoclonal antibodies e.g., anti-ganglioside GM2, anti-HER- 2, anti-pl85; Pietras et al, 1998; Hanibuchi et al, 1998; U.S. Patent 5,824,311). Herceptin (trastuzumab) is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). Table 6 is a non- limiting list of several known anticancer immunotherapeutic agents and their targets. It is contemplated that one or more of these therapies may be employed with the miRNA therapies described herein.

[00165] A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow.

Table 6. Cancer immunotherapeutics and their targets. Generic Name Target

Cetuximab EGFR

Panitumumab EGFR

Trastuzumab erbB2 receptor

Bevacizumab VEGF

Alemtuzumab CD52

Gemtuzumab ozogamicin CD33

Rituximab CD20

Tositumomab CD20

Matuzumab EGFR

Ibritumomab tiuxetan CD20

Tositumomab CD20

HuPAM4 MUCl

MORAb-009 Mesothelin

G250 carbonic anhydrase IX mAb 8H9 8H9 antigen

M195 CD33

Ipilimumab CTLA4

HuLuc63 CSl

Alemtuzumab CD53

Epratuzumab CD22

BC8 CD45

HιJ591 Prostate specific membrane antigen hA20 CD20

Lexatumumab TRAIL receptor-2

Pertuzumab HER-2 receptor

Mik-beta-1 IL-2R

RAV12 RAAG12

SGN-30 CD30

AME-133v CD20

HeFi-I CD30

BMS-663513 CD137

Volociximab anti-α5βl integrin

GC1008 TGFβ

HCD 122 CD40

Siplizumab CD2

MORAb-003 Folate receptor alpha

CNTO 328 IL-6

MDX-060 CD30

Ofatumumab CD20

SGN-33 CD33

4. Gene Therapy

[00166] In yet another embodiment, a combination treatment involves gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as one or more therapeutic miRNA. Delivery of a therapeutic polypeptide or encoding nucleic acid in conjunction with a miRNA may have a combined therapeutic effect on target tissues. A variety of proteins are encompassed within the invention, some of which are described below. Various genes that may be targeted for gene therapy of some form in combination with the present invention include, but are not limited to inducers of cellular proliferation, inhibitors

of cellular proliferation, regulators of programmed cell death, cytokines and other therapeutic nucleic acids or nucleic acid that encode therapeutic proteins.

[00167] The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. The tumor suppressors (e.g., therapeutic polypeptides) p53, FHIT, pl6 and C-CAM can be employed.

[00168] In addition to p53, another inhibitor of cellular proliferation is pl6. The major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK's. One CDK, cyclin-dependent kinase 4 (CDK4), regulates progression through the Gl. The activity of this enzyme may be to phosphorylate Rb at late Gl. The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the pl6INK4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al, 1993; Serrano et al, 1995). Since the pl6INK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein. pl6 also is known to regulate the function of CDK6.

[00169] pl6INK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6B, pi 9, p2 IWAFl, and p27KIPl. The pl6INK4 gene maps to 9p21, a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the pl6INK4 gene are frequent in human tumor cell lines. This evidence suggests that the pl6INK4 gene is a tumor suppressor gene. This interpretation has been challenged, however, by the observation that the frequency of the pl6INK4 gene alterations is much lower in primary uncultured tumors than in cultured cell lines (Caldas et al, 1994; Cheng et al, 1994; Hussussian et al, 1994; Kamb et al, 1994; Mori et al, 1994; Okamoto et al, 1994; Nobori et al, 1995; Orlow et al, 1994; Arap et al, 1995). Restoration of wild-type pl6INK4 function by transfection with a plasmid expression vector reduced colony formation by some human cancer cell lines (Okamoto, 1994; Arap, 1995).

[00170] Other genes that may be employed according to the present invention include Rb, APC, DCC, NF-I, NF-2, WT-I, MEN-I, MEN-II, zacl, p73, VHL, MMACl / PTEN, DBCCR-I, FCC, rsk-3, p27, p27/pl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-I, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, ElA, p300,

genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-I, GDAIF, or their receptors) and MCC.

5. Surgery

[00171] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.

[00172] Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.

[00173] Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.

6. Other Agents

[00174] It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-I, MIP-lbeta, MCP-I, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas / Fas ligand, DR4 or DR5 / TRAIL (Apo-2 ligand) would potentiate the apoptotic inducing abilities of the present

invention by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy.

[00175] Apo2 ligand (Apo2L, also called TRAIL) is a member of the tumor necrosis factor (TNF) cytokine family. TRAIL activates rapid apoptosis in many types of cancer cells, yet is not toxic to normal cells. TRAIL mRNA occurs in a wide variety of tissues. Most normal cells appear to be resistant to TRAIL'S cytotoxic action, suggesting the existence of mechanisms that can protect against apoptosis induction by TRAIL. The first receptor described for TRAIL, called death receptor 4 (DR4), contains a cytoplasmic "death domain"; DR4 transmits the apoptosis signal carried by TRAIL. Additional receptors have been identified that bind to TRAIL. One receptor, called DR5, contains a cytoplasmic death domain and signals apoptosis much like DR4. The DR4 and DR5 mRNAs are expressed in many normal tissues and tumor cell lines. Recently, decoy receptors such as DcRl and DcR2 have been identified that prevent TRAIL from inducing apoptosis through DR4 and DR5. These decoy receptors thus represent a novel mechanism for regulating sensitivity to a pro- apoptotic cytokine directly at the cell's surface. The preferential expression of these inhibitory receptors in normal tissues suggests that TRAIL may be useful as an anticancer agent that induces apoptosis in cancer cells while sparing normal cells. (Marsters et al, 1999).

[00176] There have been many advances in the therapy of cancer following the introduction of cytotoxic chemotherapeutic drugs. However, one of the consequences of chemotherapy is the development/acquisition of drug-resistant phenotypes and the development of multiple drug resistance. The development of drug resistance remains a major obstacle in the treatment of such tumors and therefore, there is an obvious need for alternative approaches such as gene therapy.

[00177] Another form of therapy for use in conjunction with chemotherapy, radiation therapy or biological therapy includes hyperthermia, which is a procedure in which a patient's tissue is exposed to high temperatures (up to 1060F). External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia. Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe, including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes.

[00178] A patient's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets. Alternatively, some of the patient's blood may be removed and heated before being perfused into an area that will be internally heated. Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose.

[00179] Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases.

[00180] This application incorporates U.S. Application Serial No. 11/349,727 filed on February 8, 2006 claiming priority to U.S. Provisional Application Serial No. 60/650,807 filed February 8, 2005 herein by references in its entirety.

III. MIRNA MOLECULES

[00181] MicroRNA molecules ("miRNAs") are generally 21 to 22 nucleotides in length, though lengths of 19 and up to 23 nucleotides have been reported. The miRNAs are each processed from a longer precursor RNA molecule ("precursor miRNA"). Precursor miRNAs are transcribed from non-protein-encoding genes. The precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold-back-like structure, which

is cleaved in animals by a ribonuclease Ill-like nuclease enzyme called Dicer. The processed miRNA is typically a portion of the stem.

[00182] The processed miRNA (also referred to as "mature miRNA") becomes part of a large complex to down-regulate a particular target gene or its gene product.. Examples of animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et ah, 1999; Seggerson et ah, 2002). siRNA molecules also are processed by Dicer, but from a long, double-stranded RNA molecule. siRNAs are not naturally found in animal cells, but they can direct the sequence-specific cleavage of an mRNA target through a RNA-induced silencing complex (RISC) (Denli et al, 2003).

A. Array Preparation

[00183] Certain embodiments of the present invention concerns the preparation and use of mRNA or nucleic acid arrays, miRNA or nucleic acid arrays, and/or miRNA or nucleic acid probe arrays, which are macroarrays or microarrays of nucleic acid molecules (probes) that are fully or nearly complementary (over the length of the prove) or identical (over the length of the prove) to a plurality of nucleic acid, mRNA or miRNA molecules, precursor miRNA molecules, or nucleic acids derived from the various genes and gene pathways modulated by miR-34 miRNAs and that are positioned on a support or support material in a spatially separated organization. Macroarrays are typically sheets of nitrocellulose or nylon upon which probes have been spotted. Microarrays position the nucleic acid probes more densely such that up to 10,000 nucleic acid molecules can be fit into a region typically 1 to 4 square centimeters. Microarrays can be fabricated by spotting nucleic acid molecules, e.g., genes, oligonucleotides, etc., onto substrates or fabricating oligonucleotide sequences in situ on a substrate. Spotted or fabricated nucleic acid molecules can be applied in a high density matrix pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or higher, e.g. up to about 100 or even 1000 per square centimeter. Microarrays typically use coated glass as the solid support, in contrast to the nitrocellulose-based material of filter arrays. By having an ordered array of marker RNA and/or miRNA-complementing nucleic acid samples, the position of each sample can be tracked and linked to the original sample.

[00184] A variety of different array devices in which a plurality of distinct nucleic acid probes are stably associated with the surface of a solid support are known to those of skill in the art. Useful substrates for arrays include nylon, glass, metal, plastic, latex, and silicon. Such arrays may vary in a number of different ways, including average probe length,

sequence or types of probes, nature of bond between the probe and the array surface, e.g. covalent or non-covalent, and the like. The labeling and screening methods of the present invention and the arrays are not limited in its utility with respect to any parameter except that the probes detect miRNA, or genes or nucleic acid representative of genes; consequently, methods and compositions may be used with a variety of different types of nucleic acid arrays.

[00185] Representative methods and apparatus for preparing a microarray have been described, for example, in U.S. Patents 5,143,854; 5,202,231; 5,242,974; 5,288,644; 5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049; 5,436,327; 5,445,934; 5,468,613; 5,470,710; 5,472,672; 5,492,806; 5,525,464; 5,503,980; 5,510,270; 5,525,464; 5,527,681; 5,529,756; 5,532,128; 5,545,531; 5,547,839; 5,554,501; 5,556,752; 5,561,071; 5,571,639; 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672; 5,610;287; 5,624,711; 5,631,134; 5,639,603; 5,654,413; 5,658,734; 5,661,028; 5,665,547; 5,667,972; 5,695,940; 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645; 5,837,196; 5,871,928; 5,847,219; 5,876,932; 5,919,626; 6,004,755; 6,087,102; 6,368,799; 6,383,749; 6,617,112; 6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995; WO 95/21265; WO 95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO 97/27317; WO 99/35505; WO 09923256; WO 09936760; WO0138580; WO 0168255; WO 03020898; WO 03040410; WO 03053586; WO 03087297; WO 03091426; WO03100012; WO 04020085; WO 04027093; EP 373 203; EP 785 280; EP 799 897 and UK 8 803 000; the disclosures of which are all herein incorporated by reference.

[00186] It is contemplated that the arrays can be high density arrays, such that they contain 2, 20, 25, 50, 80, 100 or more different probes. It is contemplated that they may contain 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different probes. The probes can be directed to mRNA and/or miRNA targets in one or more different organisms or cell types. The oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, 9 to 34, or 15 to 40 nucleotides in length in some embodiments. In certain embodiments, the oligonucleotide probes are 5, 10, 15, 20 to 20, 25, 30, 35, 40 nucleotides in length including all integers and ranges there between.

[00187] The location and sequence of each different probe sequence in the array are generally known. Moreover, the large number of different probes can occupy a relatively small area providing a high density array having a probe density of generally greater than

about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different oligonucleotide probes per cm2. The surface area of the array can be about or less than about 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cm2.

[00188] Moreover, a person of ordinary skill in the art could readily analyze data generated using an array. Such protocols are disclosed above, and include information found in WO 9743450; WO 03023058; WO 03022421; WO 03029485; WO 03067217; WO 03066906; WO 03076928; WO 03093810; WO 03100448A1, all of which are specifically incorporated by reference.

B. Sample Preparation

[00189] It is contemplated that the RNA and/or miRNA of a wide variety of samples can be analyzed using the arrays, index of probes, or array technology of the invention. While endogenous miRNA is contemplated for use with compositions and methods of the invention, recombinant miRNA - including nucleic acids that are complementary or identical to endogenous miRNA or precursor miRNA - can also be handled and analyzed as described herein. Samples may be biological samples, in which case, they can be from biopsy, fine needle aspirates, exfoliates, blood, tissue, organs, semen, saliva, tears, other bodily fluid, hair follicles, skin, or any sample containing or constituting biological cells, particularly cancer or hyperproliferative cells. In certain embodiments, samples may be, but are not limited to, biopsy, or cells purified or enriched to some extent from a biopsy or other bodily fluids or tissues. Alternatively, the sample may not be a biological sample, but be a chemical mixture, such as a cell-free reaction mixture (which may contain one or more biological enzymes).

C. Hybridization

[00190] After an array or a set of probes is prepared and/or the nucleic acid in the sample or probe is labeled, the population of target nucleic acids is contacted with the array or probes under hybridization conditions, where such conditions can be adjusted, as desired, to provide for an optimum level of specificity in view of the particular assay being performed. Suitable hybridization conditions are well known to those of skill in the art and reviewed in Sambrook et al. (2001) and WO 95/21944. Of particular interest in many embodiments is the use of stringent conditions during hybridization. Stringent conditions are known to those of skill in the art.

[00191] It is specifically contemplated that a single array or set of probes may be contacted with multiple samples. The samples may be labeled with different labels to distinguish the samples. For example, a single array can be contacted with a tumor tissue sample labeled with Cy3, and normal tissue sample labeled with Cy5. Differences between the samples for particular miRNAs corresponding to probes on the array can be readily ascertained and quantified.

[00192] The small surface area of the array permits uniform hybridization conditions, such as temperature regulation and salt content. Moreover, because of the small area occupied by the high density arrays, hybridization may be carried out in extremely small fluid volumes (e.g., about 250 μl or less, including volumes of about or less than about 5, 10, 25, 50, 60, 70, 80, 90, 100 μl, or any range derivable therein). In small volumes, hybridization may proceed very rapidly.

D. Differential Expression Analyses

[00193] Arrays of the invention can be used to detect differences between two samples. Specifically contemplated applications include identifying and/or quantifying differences between miRNA or gene expression from a sample that is normal and from a sample that is not normal, between a disease or condition and a cell not exhibiting such a disease or condition, or between two differently treated samples. Also, miRNA or gene expression may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition. A sample that is not normal is one exhibiting phenotypic or genotypic trait(s) of a disease or condition, or one believed to be not normal with respect to that disease or condition. It may be compared to a cell that is normal with respect to that disease or condition. Phenotypic traits include symptoms of, or susceptibility to, a disease or condition of which a component is or may or may not be genetic, or caused by a hyperproliferative or neoplastic cell or cells.

[00194] An array comprises a solid support with nucleic acid probes attached to the support. Arrays typically comprise a plurality of different nucleic acid probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as "microarrays" or colloquially "chips" have been generally described in the art, for example, U.S. Patents 5,143,854, 5,445,934, 5,744,305, 5,677,195, 6,040,193, 5,424,186 and Fodor et al, (1991), each of which is incorporated by reference in its entirety for all purposes.

Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Patent 5,384,261, incorporated herein by reference in its entirety for all purposes. Although a planar array surface is used in certain aspects, the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Patents 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, which are hereby incorporated in their entirety for all purposes. Arrays may be packaged in such a manner as to allow for diagnostics or other manipulation of an all inclusive device, see for example, U.S. Patents 5,856,174 and 5,922,591 incorporated in their entirety by reference for all purposes. See also U.S. patent application Ser. No. 09/545,207, filed April. 7, 2000 for additional information concerning arrays, their manufacture, and their characteristics, which is incorporated by reference in its entirety for all purposes.

[00195] Particularly, arrays can be used to evaluate samples with respect to pathological condition such as cancer and related conditions. It is specifically contemplated that the invention can be used to evaluate differences between stages or sub-classifications of disease, such as between benign, cancerous, and metastatic tissues or tumors.

[00196] Phenotypic traits to be assessed include characteristics such as longevity, morbidity, expected survival, susceptibility or receptivity to particular drugs or therapeutic treatments (drug efficacy), and risk of drug toxicity. Samples that differ in these phenotypic traits may also be evaluated using the compositions and methods described.

[00197] In certain embodiments, miRNA and/or expression profiles may be generated to evaluate and correlate those profiles with pharmacokinetics or therapies. For example, these profiles may be created and evaluated for patient tumor and blood samples prior to the patient's being treated or during treatment to determine if there are miRNA or genes whose expression correlates with the outcome of the patient's treatment. Identification of differential miRNAs or genes can lead to a diagnostic assay for evaluation of tumor and/or blood samples to determine what drug regimen the patient should be provided. In addition, it can be used to identify or select patients suitable for a particular clinical trial. If an expression profile is determined to be correlated with drug efficacy or drug toxicity, that profile is relevant to whether that patient is an appropriate patient for receiving a drug, for receiving a combination of drugs, or for a particular dosage of the drug.

[00198] In addition to the above prognostic assay, samples from patients with a variety of diseases can be evaluated to determine if different diseases can be identified based on miRNA and/or related gene expression levels. A diagnostic assay can be created based on the profiles that doctors can use to identify individuals with a disease or who are at risk to develop a disease. Alternatively, treatments can be designed based on miRNA profiling. Examples of such methods and compositions are described in the U.S. Provisional Patent Application entitled "Methods and Compositions Involving miRNA and miRNA Inhibitor Molecules" filed on May 23, 2005 in the names of David Brown, Lance Ford, Angie Cheng and Rich Jarvis, which is hereby incorporated by reference in its entirety.

E. Other Assays

[00199] In addition to the use of arrays and microarrays, it is contemplated that a number of different assays could be employed to analyze miRNAs or related genes, their activities, and their effects. Such assays include, but are not limited to, nucleic acid amplification, polymerase chain reaction, quantitative PCR, RT-PCR, in situ hybridization, Northern hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA (bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies), and/or Bridge Litigation Assay (Genaco).

IV. NUCLEIC ACIDS

[00200] The present invention concerns nucleic acids, modified or mimetic nucleic acids, miRNAs, mRNAs, genes, and representative fragments thereof that can be labeled, used in array analysis, or employed in diagnostic, therapeutic, or prognostic applications, particularly those related to pathological conditions such as cancer. The molecules may have been endogenously produced by a cell, or been synthesized or produced chemically or recombinantly. They may be isolated and/or purified. Each of the miRNAs described herein and includes the corresponding SEQ ID NO and accession numbers for these miRNA sequences. The name of a miRNA is often abbreviated and referred to without a "hsa-" prefix and will be understood as such, depending on the context. Unless otherwise indicated, miRNAs referred to in the application are human sequences identified as miR-X or let-X, where X is a number and/or letter.

[00201] In certain aspects, a miRNA probe designated by a suffix "5P" or "3P" can be used. "5P" indicates that the mature miRNA derives from the 5' end of the precursor and a corresponding "3P" indicates that it derives from the 3' end of the precursor, as described on the world wide web at sanger.ac.uk. Moreover, in some embodiments, a miRNA probe is used that does not correspond to a known human miRNA. It is contemplated that these non- human miRNA probes may be used in embodiments of the invention or that there may exist a human miRNA that is homologous to the non-human miRNA. In other embodiments, any mammalian cell, biological sample, or preparation thereof may be employed.

[00202] In some embodiments of the invention, methods and compositions involving miRNA may concern miRNA, markers (mRNAs), and/or other nucleic acids. Nucleic acids may be, be at least, or be at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides, or any range derivable therein, in length. Such lengths cover the lengths of processed miRNA, miRNA probes, precursor miRNA, miRNA containing vectors, mRNA, mRNA probes, control nucleic acids, and other probes and primers.

[00203] In many embodiments, miRNA are 19-24 nucleotides in length, while miRNA probes are 19-35 nucleotides in length, depending on the length of the processed miRNA and any flanking regions added. miRNA precursors are generally between 62 and 110 nucleotides in humans.

[00204] Nucleic acids of the invention may have regions of identity or complementarity to another nucleic acid. It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region is, is at least, or is at most 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,

52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 contiguous nucleotides. It is further understood that the length of complementarity within a precursor miRNA or other nucleic acid or between a miRNA probe and a miRNA or a miRNA gene are such lengths. Moreover, the complementarity may be expressed as a percentage, meaning that the complementarity between a probe and its target is 90% or greater over the length of the probe. In some embodiments, complementarity is or is at least 90%, 95% or 100%. In particular, such lengths may be applied to any nucleic acid comprising a nucleic acid sequence identified in any of SEQ ID NOs described herein, accession number, or any other sequence disclosed herein. Typically, the commonly used name of the miRNA is given (with its identifying source in the prefix, for example, "hsa" for human sequences) and the processed miRNA sequence. Unless otherwise indicated, a miRNA without a prefix will be understood to refer to a human miRNA. Moreover, a lowercase letter in a miRNA name may or may not be lowercase; for example, hsa-mir-130b can also be referred to as miR-130B. The term "miRNA probe" refers to a nucleic acid probe that can identify a particular miRNA or structurally related miRNAs.

[00205] It is understood that some nucleic acids are derived from genomic sequences or a gene. In this respect, the term "gene" is used for simplicity to refer to the genomic sequence encoding the precursor nucleic acid or miRNA for a given miRNA or gene. However, embodiments of the invention may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences.

[00206] The term "recombinant" may be used and this generally refers to a molecule that has been manipulated in vitro or that is a replicated or expressed product of such a molecule.

[00207] The term "nucleic acid" is well known in the art. A "nucleic acid" as used herein will generally refer to a molecule (one or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA {e.g., an adenine "A," a guanine "G," a

thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The term "nucleic acid" encompasses the terms "oligonucleotide" and "polynucleotide," each as a subgenus of the term "nucleic acid."

[00208] The term "miRNA" generally refers to a single-stranded molecule, but in specific embodiments, molecules implemented in the invention will also encompass a region or an additional strand that is partially (between 10 and 50% complementary across length of strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid. Thus, nucleic acids of the invention may encompass a molecule that comprises one or more complementary or self-complementary strand(s) or "complement(s)" of a particular sequence. For example, precursor miRNA may have a self-complementary region, which is up to 100% complementary. miRNA probes or nucleic acids of the invention can include, can be or can be at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100% complementary to their target.

[00209] It is understood that a "synthetic nucleic acid" of the invention means that the nucleic acid does not have all or part of a chemical structure or sequence of a naturally occurring nucleic acid. Consequently, it will be understood that the term "synthetic miRNA" refers to a "synthetic nucleic acid" that functions in a cell or under physiological conditions as a naturally occurring miRNA.

[00210] While embodiments of the invention may involve synthetic miRNAs or synthetic nucleic acids, in some embodiments of the invention, the nucleic acid molecule(s) need not be "synthetic." In certain embodiments, a non-synthetic nucleic acid or miRNA employed in methods and compositions of the invention may have the entire sequence and structure of a naturally occurring mRNA or miRNA precursor or the mature mRNA or miRNA. For example, non-synthetic miRNAs used in methods and compositions of the invention may not have one or more modified nucleotides or nucleotide analogs. In these embodiments, the non-synthetic miRNA may or may not be recombinantly produced. In particular embodiments, the nucleic acid in methods and/or compositions of the invention is specifically a synthetic miRNA and not a non-synthetic miRNA (that is, not a miRNA that qualifies as "synthetic"); though in other embodiments, the invention specifically involves a non- synthetic miRNA and not a synthetic miRNA. Any embodiments discussed with respect to

the use of synthetic miRNAs can be applied with respect to non-synthetic miRNAs, and vice versa.

[00211] It will be understood that the term "naturally occurring" refers to something found in an organism without any intervention by a person; it could refer to a naturally-occurring wildtype or mutant molecule. In some embodiments a synthetic miRNA molecule does not have the sequence of a naturally occurring miRNA molecule. In other embodiments, a synthetic miRNA molecule may have the sequence of a naturally occurring miRNA molecule, but the chemical structure of the molecule, particularly in the part unrelated specifically to the precise sequence (non-sequence chemical structure) differs from chemical structure of the naturally occurring miRNA molecule with that sequence. In some cases, the synthetic miRNA has both a sequence and non-sequence chemical structure that are not found in a naturally-occurring miRNA. Moreover, the sequence of the synthetic molecules will identify which miRNA is effectively being provided or inhibited; the endogenous miRNA will be referred to as the "corresponding miRNA." Corresponding miRNA sequences that can be used in the context of the invention include, but are not limited to, all or a portion of those sequences in the SEQ IDs provided herein, as well as any other miRNA sequence, miRNA precursor sequence, or any sequence complementary thereof. In some embodiments, the sequence is or is derived from or contains all or part of a sequence identified herein to target a particular miRNA (or set of miRNAs) that can be used with that sequence. Any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260 or any number or range of sequences there between may be selected to the exclusion of all non-selected sequences.

[00212] As used herein, "hybridization", "hybridizes" or "capable of hybridizing" is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term "anneal" as used herein is synonymous with "hybridize." The term "hybridization", "hybridize(s)" or "capable of hybridizing" encompasses the terms "stringent condition(s)" or "high stringency" and the terms "low stringency" or "low stringency condition(s)."

[00213] As used herein "stringent condition(s)" or "high stringency" are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but preclude hybridization of random sequences. Stringent

conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like.

[00214] Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.5 M NaCl at temperatures of about 42°C to about 700C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture.

[00215] It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting examples only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is preferred to employ varying conditions of hybridization to achieve varying degrees of selectivity of a nucleic acid towards a target sequence. In a non-limiting example, identification or isolation of a related target nucleic acid that does not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions," and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 200C to about 500C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suite a particular application.

A. Nucleobase, Nucleoside, Nucleotide, and Modified Nucleotides

[00216] As used herein a "nucleobase" refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase. A nucleobase generally can form one or more hydrogen bonds ("anneal" or "hybridize") with at least one naturally occurring

nucleobase in a manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).

[00217] "Purine" and/or "pyrimidine" nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moiety. Preferred alkyl (e.g., alkyl, caboxyalkyl, etc.) moieties comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Other non-limiting examples of a purine or pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine, a 8-aminoguanine, a 8-hydroxyguanine, a 8-methylguanine, a 8-thioguanine, an azaguanine, a 2-aminopurine, a 5- ethylcytosine, a 5 -methyl cyosine, a 5-bromouracil, a 5-ethyluracil, a 5-iodouracil, a 5- chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a methylthioadenine, a N ,N- diemethyladenine, an azaadenines, a 8-bromoadenine, a 8-hydroxyadenine, a 6- hydroxyaminopurine, a 6-thiopurine, a 4-(6-aminohexyl/cytosine), and the like. Other examples are well known to those of skill in the art.

[00218] As used herein, a "nucleoside" refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a "nucleobase linker moiety" is a sugar comprising 5-carbon atoms (i.e., a "5-carbon sugar"), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring. Different types of covalent attachment(s) of a nucleobase to a nucleobase linker moiety are known in the art (Kornberg and Baker, 1992).

[00219] As used herein, a "nucleotide" refers to a nucleoside further comprising a "backbone moiety". A backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid. The "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5 '-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety.

[00220] A nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. RNA with nucleic acid analogs may also be labeled according to methods of the invention. As used herein a "derivative" refers to a chemically modified or altered form of a naturally occurring molecule, while the terms "mimic" or "analog" refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions. As used herein, a "moiety" generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference).

[00221] Additional non-limiting examples of nucleosides, nucleotides or nucleic acids include those in: U.S. Patents 5,681,947, 5,652,099 and 5,763,167, 5,614,617, 5,670,663, 5,872,232, 5,859,221, 5,446,137, 5,886,165, 5,714,606, 5,672,697, 5,466,786, 5,792,847, 5,223,618, 5,470,967, 5,378,825, 5,777,092, 5,623,070, 5,610,289, 5,602,240, 5,858,988, 5,214,136, 5,700,922, 5,708,154, 5,728,525, 5,637,683, 6,251,666, 5,480,980, and 5,728,525, each of which is incorporated herein by reference in its entirety.

[00222] Labeling methods and kits of the invention specifically contemplate the use of nucleotides that are both modified for attachment of a label and can be incorporated into a miRNA molecule. Such nucleotides include those that can be labeled with a dye, including a fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are readily available; they can be acquired commercially or they can be synthesized by reactions known to those of skill in the art.

[00223] Modified nucleotides for use in the invention are not naturally occurring nucleotides, but instead, refer to prepared nucleotides that have a reactive moiety on them. Specific reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorotriazine, dichlorotriazine, mono-or dihalogen substituted pyridine, mono- or disubstituted diazine, maleimide, epoxide, aziridine, sulfonyl halide, acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hydroxysuccinimide ester, imido ester, hydrazine, azidonitrophenyl, azide, 3-(2-pyridyl dithio)-propionamide, glyoxal, aldehyde, iodoacetyl, cyanomethyl ester, p- nitrophenyl ester, o-nitrophenyl ester, hydroxypyridine ester, carbonyl imidazole, and the

other such chemical groups. In some embodiments, the reactive functionality may be bonded directly to a nucleotide, or it may be bonded to the nucleotide through a linking group. The functional moiety and any linker cannot substantially impair the ability of the nucleotide to be added to the miRNA or to be labeled. Representative linking groups include carbon containing linking groups, typically ranging from about 2 to 18, usually from about 2 to 8 carbon atoms, where the carbon containing linking groups may or may not include one or more heteroatoms, e.g. S, O, N etc., and may or may not include one or more sites of unsaturation. Of particular interest in many embodiments is alkyl linking groups, typically lower alkyl linking groups of 1 to 16, usually 1 to 4 carbon atoms, where the linking groups may include one or more sites of unsaturation. The functionalized nucleotides (or primers) used in the above methods of functionalized target generation may be fabricated using known protocols or purchased from commercial vendors, e.g., Sigma, Roche, Ambion, Biosearch Technologies and NEN. Functional groups may be prepared according to ways known to those of skill in the art, including the representative information found in U.S. Patents 4,404,289; 4,405,711; 4,337,063 and 5,268,486, and U.K.. Patent 1,529,202, which are all incorporated by reference.

[00224] Amine-modifϊed nucleotides are used in several embodiments of the invention. The amine-modified nucleotide is a nucleotide that has a reactive amine group for attachment of the label. It is contemplated that any ribonucleotide (G, A, U, or C) or deoxyribonucleotide (G, A, T, or C) can be modified for labeling. Examples include, but are not limited to, the following modified ribo- and deoxyribo-nucleo tides: 5-(3-aminoallyl)- UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N6-(4- amino)butyl-ATP, N6-(6-amino)butyl-ATP, N4-[2,2-oxy-bis-(ethylamine)]-CTP; N6-(6- Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-propargylamino-CTP, 5- propargylamino-UTP; 5-(3-aminoallyl)-dUTP; 8-[(4-amino)butyl]-amino-dATP and 8-[(6- amino)butyl]-amino-dATP; N6-(4-amino)butyl-dATP, N6-(6-amino)butyl-dATP, N4-[2,2- oxy-bis-(ethylamine)]-dCTP; N6-(6-Amino)hexyl-dATP; 8-[(6-Amino)hexyl]-amino-dATP; 5-propargylamino-dCTP, and 5-propargylamino-dUTP. Such nucleotides can be prepared according to methods known to those of skill in the art. Moreover, a person of ordinary skill in the art could prepare other nucleotide entities with the same amine-modification, such as a 5-(3-aminoallyl)-CTP, GTP, ATP, dCTP, dGTP, dTTP, or dUTP in place of a 5-(3- aminoallyl)-UTP.

B. Preparation of Nucleic Acids

[00225] A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production, or biological production. It is specifically contemplated that miRNA probes of the invention are chemically synthesized.

[00226] In some embodiments of the invention, miRNAs are recovered or isolated from a biological sample. The miRNA may be recombinant or it may be natural or endogenous to the cell (produced from the cell's genome). It is contemplated that a biological sample may be treated in a way so as to enhance the recovery of small RNA molecules such as miRNA. U.S. Patent Application Serial No. 10/667,126 describes such methods and it is specifically incorporated by reference herein. Generally, methods involve lysing cells with a solution having guanidinium and a detergent.

[00227] Alternatively, nucleic acid synthesis is performed according to standard methods. See, for example, Itakura and Riggs (1980) and U.S. Patents 4,704,362, 5,221,619, and 5,583,013, each of which is incorporated herein by reference. Non- limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite, or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986 and U.S. Patent 5,705,629, each incorporated herein by reference. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

[00228] A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Patents 4,683,202 and 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference. See also Sambrook et al., 2001, incorporated herein by reference).

[00229] Oligonucleotide synthesis is well known to those of skill in the art. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S.

Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

[00230] Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art. These include the use of vectors (viral and non-viral), plasmids, cosmids, and other vehicles for delivering a nucleic acid to a cell, which may be the target cell (e.g., a cancer cell) or simply a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.

C. Isolation of Nucleic Acids

[00231] Nucleic acids may be isolated using techniques well known to those of skill in the art, though in particular embodiments, methods for isolating small nucleic acid molecules, and/or isolating RNA molecules can be employed. Chromatography is a process often used to separate or isolate nucleic acids from protein or from other nucleic acids. Such methods can involve electrophoresis with a gel matrix, filter columns, alcohol precipitation, and/or other chromatography. If miRNA from cells is to be used or evaluated, methods generally involve lysing the cells with a chaotropic (e.g., guanidinium isothiocyanate) and/or detergent (e.g., N-lauroyl sarcosine) prior to implementing processes for isolating particular populations of RNA.

[00232] In particular methods for separating miRNA from other nucleic acids, a gel matrix is prepared using polyacrylamide, though agarose can also be used. The gels may be graded by concentration or they may be uniform. Plates or tubing can be used to hold the gel matrix for electrophoresis. Usually one-dimensional electrophoresis is employed for the separation of nucleic acids. Plates are used to prepare a slab gel, while the tubing (glass or rubber, typically) can be used to prepare a tube gel. The phrase "tube electrophoresis" refers to the use of a tube or tubing, instead of plates, to form the gel. Materials for implementing tube electrophoresis can be readily prepared by a person of skill in the art or purchased, such as from C. B. S. Scientific Co., Inc. or Scie-Plas.

[00233] Methods may involve the use of organic solvents and/or alcohol to isolate nucleic acids, particularly miRNA used in methods and compositions of the invention. Some

embodiments are described in U.S. Patent Application Serial No. 10/667,126, which is hereby incorporated by reference. Generally, this disclosure provides methods for efficiently isolating small RNA molecules from cells comprising: adding an alcohol solution to a cell lysate and applying the alcohol/lysate mixture to a solid support before eluting the RNA molecules from the solid support. In some embodiments, the amount of alcohol added to a cell lysate achieves an alcohol concentration of about 55% to 60%. While different alcohols can be employed, ethanol works well. A solid support may be any structure, and it includes beads, filters, and columns, which may include a mineral or polymer support with electronegative groups. A glass fiber filter or column has worked particularly well for such isolation procedures.

[00234] In specific embodiments, miRNA isolation processes include: a) lysing cells in the sample with a lysing solution comprising guanidinium, wherein a lysate with a concentration of at least about 1 M guanidinium is produced; b) extracting miRNA molecules from the lysate with an extraction solution comprising phenol; c) adding to the lysate an alcohol solution for forming a lysate/alcohol mixture, wherein the concentration of alcohol in the mixture is between about 35% to about 70%; d) applying the lysate/alcohol mixture to a solid support; e) eluting the miRNA molecules from the solid support with an ionic solution; and, f) capturing the miRNA molecules. Typically the sample is dried and resuspended in a liquid and volume appropriate for subsequent manipulation.

V. LABELS AND LABELING TECHNIQUES

[00235] In some embodiments, the present invention concerns miRNA that are labeled. It is contemplated that miRNA may first be isolated and/or purified prior to labeling. This may achieve a reaction that more efficiently labels the miRNA, as opposed to other RNA in a sample in which the miRNA is not isolated or purified prior to labeling. In many embodiments of the invention, the label is non-radioactive. Generally, nucleic acids may be labeled by adding labeled nucleotides (one-step process) or adding nucleotides and labeling the added nucleotides (two-step process).

A. Labeling Techniques

[00236] In some embodiments, nucleic acids are labeled by catalytically adding to the nucleic acid an already labeled nucleotide or nucleotides. One or more labeled nucleotides

can be added to miRNA molecules. See U.S. Patent 6,723,509, which is hereby incorporated by reference.

[00237] In other embodiments, an unlabeled nucleotide or nucleotides is catalytically added to a miRNA, and the unlabeled nucleotide is modified with a chemical moiety that enables it to be subsequently labeled. In embodiments of the invention, the chemical moiety is a reactive amine such that the nucleotide is an amine-modified nucleotide. Examples of amine-modified nucleotides are well known to those of skill in the art, many being commercially available such as from Ambion, Sigma, Jena Bioscience, and TriLink.

[00238] In contrast to labeling of cDNA during its synthesis, the issue for labeling miRNA is how to label the already existing molecule. The present invention concerns the use of an enzyme capable of using a di- or tri-phosphate ribonucleotide or deoxyribonucleotide as a substrate for its addition to a miRNA. Moreover, in specific embodiments, it involves using a modified di- or tri-phosphate ribonucleotide, which is added to the 3' end of a miRNA. Enzymes capable of adding such nucleotides include, but are not limited to, poly (A) polymerase, terminal transferase, and polynucleotide phosphorylase. In specific embodiments of the invention, a ligase is contemplated as not being the enzyme used to add the label, and instead, a non-ligase enzyme is employed. Terminal transferase catalyzes the addition of nucleotides to the 3' terminus of a nucleic acid. Polynucleotide phosphorylase can polymerize nucleotide diphosphates without the need for a primer.

B. Labels

[00239] Labels on miRNA or miRNA probes may be colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, enzymatic, or positron emitting (including radioactive). The label may be detected directly or indirectly. Radioactive labels include I, P, P, and S. Examples of enzymatic labels include alkaline phosphatase, luciferase, horseradish peroxidase, and β-galactosidase. Labels can also be proteins with luminescent properties, e.g., green fluorescent protein and phycoerythrin.

[00240] The colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4- methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate;

macrocyclic chelates of lanthanide ions, such as Quantum Dye™; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; , fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer; and, TOTAB.

[00241] Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2',4',5',7'-Tetrabromosulfonefluorescein, and TET.

[00242] Specific examples of fluorescently labeled ribonucleotides are available from Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein- 12-UTP, BODIPY FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14- UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP.

[00243] Examples of fluorescently labeled deoxyribonucleotides include Dinitrophenyl (DNP)-11-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein- 12-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546- 14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY TR- 14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14- dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594- 7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP.

[00244] It is contemplated that nucleic acids may be labeled with two different labels. Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of

the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each incorporated by reference).

[00245] Alternatively, the label may not be detectable per se, but indirectly detectable or allowing for the isolation or separation of the targeted nucleic acid. For example, the label could be biotin, digoxigenin, polyvalent cations, chelator groups and the other ligands, include ligands for an antibody.

C. Visualization Techniques

[00246] A number of techniques for visualizing or detecting labeled nucleic acids are readily available. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody-based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al., 1997), spectroscopy, capillary gel electrophoresis (Cummins et al., 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance techniques.

[00247] When two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize association of one or more nucleic acid. Furthermore, a person of ordinary skill in the art is well aware of ways of visualizing, identifying, and characterizing labeled nucleic acids, and accordingly, such protocols may be used as part of the invention. Examples of tools that may be used also include fluorescent microscopy, a BioAnalyzer, a plate reader, Storm (Molecular Dynamics), Array Scanner, FACS (fluorescent activated cell sorter), or any instrument that has the ability to excite and detect a fluorescent molecule.

VI. KITS

[00248] Any of the compositions described herein may be comprised in a kit. In a non- limiting example, reagents for isolating miRNA, labeling miRNA, and/or evaluating a miRNA population using an array, nucleic acid amplification, and/or hybridization can be included in a kit, as well reagents for preparation of samples from blood samples. The kit may further include reagents for creating or synthesizing miRNA probes. The kits will thus comprise, in suitable container means, an enzyme for labeling the miRNA by incorporating labeled nucleotide or unlabeled nucleotides that are subsequently labeled. In certain aspects, the kit can include amplification reagents. In other aspects, the kit may include various

supports, such as glass, nylon, polymeric beads, and the like, and/or reagents for coupling any probes and/or target nucleic acids. It may also include one or more buffers, such as reaction buffer, labeling buffer, washing buffer, or a hybridization buffer, compounds for preparing the miRNA probes, and components for isolating miRNA. Other kits of the invention may include components for making a nucleic acid array comprising miRNA, and thus, may include, for example, a solid support.

[00249] Kits for implementing methods of the invention described herein are specifically contemplated. In some embodiments, there are kits for preparing miRNA for multi-labeling and kits for preparing miRNA probes and/or miRNA arrays. In these embodiments, kit comprise, in suitable container means, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more of the following: (1) poly(A) polymerase; (2) unmodified nucleotides (G, A, T, C, and/or U); (3) a modified nucleotide (labeled or unlabeled); (4) poly(A) polymerase buffer; and, (5) at least one microfilter; (6) label that can be attached to a nucleotide; (7) at least one miRNA probe; (8) reaction buffer; (9) a miRNA array or components for making such an array; (10) acetic acid; (11) alcohol; (12) solutions for preparing, isolating, enriching, and purifying miRNAs or miRNA probes or arrays. Other reagents include those generally used for manipulating RNA, such as formamide, loading dye, ribonuclease inhibitors, and DNase.

[00250] In specific embodiments, kits of the invention include an array containing miRNA probes, as described in the application. An array may have probes corresponding to all known miRNAs of an organism or a particular tissue or organ in particular conditions, or to a subset of such probes. The subset of probes on arrays of the invention may be or include those identified as relevant to a particular diagnostic, therapeutic, or prognostic application. For example, the array may contain one or more probes that is indicative or suggestive of (1) a disease or condition (acute myeloid leukemia), (2) susceptibility or resistance to a particular drug or treatment; (3) susceptibility to toxicity from a drug or substance; (4) the stage of development or severity of a disease or condition (prognosis); and (5) genetic predisposition to a disease or condition.

[00251] For any kit embodiment, including an array, there can be nucleic acid molecules that contain or can be used to amplify a sequence that is a variant of, identical to or complementary to all or part of any of SEQ IDs described herein. In certain embodiments, a kit or array of the invention can contain one or more probes for the miRNAs identified by the

SEQ IDs described herein. Any nucleic acid discussed above may be implemented as part of a kit.

[00252] The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained.

[00253] When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.

[00254] However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means. In some embodiments, labeling dyes are provided as a dried power. It is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 μg or at least or at most those amounts of dried dye are provided in kits of the invention. The dye may then be resuspended in any suitable solvent, such as DMSO.

[00255] Such kits may also include components that facilitate isolation of the labeled miRNA. It may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.

[00256] A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.

[00257] Kits of the invention may also include one or more of the following: Control RNA; nuclease-free water; RNase-free containers, such as 1.5 ml tubes; RNase-free elution tubes; PEG or dextran; ethanol; acetic acid; sodium acetate; ammonium acetate; guanidinium; detergent; nucleic acid size marker; RNase-free tube tips; and RNase or DNase inhibitors.

[00258] It is contemplated that such reagents are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.

VII. EXAMPLES

[00259] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1:

GENE EXPRESSION ANALYSIS FOLLOWING TRANSFECTION

WITH HSA-MIR-34A

[00260] miRNAs are believed to regulate gene expression by binding to target mRNA transcripts and (1) initiating transcript degradation or (2) altering protein translation from the transcript. Translational regulation leading to an up or down change in protein expression may lead to changes in activity and expression of downstream gene products and genes that are in turn regulated by those proteins. These numerous regulatory effects may be revealed as changes in the global mRNA expression profile. Microarray gene expression analyses were performed to identify genes that are mis-regulated by hsa-miR-34a expression.

[00261] Synthetic pre-miR-34a (Ambion) or two negative control miRNAs (pre-miR-NCl, Ambion cat. no. AM17110 and pre-miR-NC2, Ambion, cat. no. AM17111) were reverse transfected into quadruplicate samples of A549 cells for each of three time points. Cells were transfected using siPORT NeoFX (Ambion) according to the manufacturer's recommendations using the following parameters: 200,000 cells per well in a 6 well plate, 5.0 μl of NeoFX, 30 nM final concentration of miRNA in 2.5 ml. Cells were harvested at 4 h, 24 h, and 72 h post transfection. Total RNA was extracted using RNAqueous-4PCR (Ambion) according to the manufacturer's recommended protocol.

[00262] mRNA array analyses were performed by Asuragen Services (Austin,TX), according to the company's standard operating procedures. Using the MessageAmp™ 11-96 aRNA Amplification KJt (Ambion, cat #1819) 2 μg of total RNA were used for target preparation and labeling with biotin. cRNA yields were quantified using an Agilent Bioanalyzer 2100 capillary electrophoresis protocol. Labeled target was hybridized to Affymetrix mRNA arrays (Human HG-Ul 33 A 2.0 arrays) using the manufacturer's recommendations and the following parameters. Hybridizations were carried out at 45°C for 16 hr in an Affymetrix Model 640 hybridization oven. Arrays were washed and stained on an Affymetrix FS450 Fluidics station, running the wash script Midi_euk2v3_450. The arrays were scanned on a Affymetrix GeneChip Scanner 3000. Summaries of the image signal data, group mean values, p-values with significance flags, log ratios and gene annotations for every gene on the array were generated using the Affymetrix Statistical Alogrithm MAS 5.0 (GCOS vl.3). Data were reported in a file (cabinet) containing the Affymetrix data and result files and in files (.eel) containing the primary image and processed cell intensities of the arrays. Data were normalized for the effect observed by the average of two negative control microRNA sequences and then were averaged together for presentation. A list of genes whose expression levels varied by at least 0.7 log2 from the average negative control was assembled. Results of the microarray gene expression analysis are shown in Table 1.

[00263] Manipulation of the expression levels of the genes listed in Table 1 represents a potentially useful therapy for cancer and other diseases in which increased or reduced expression of hsa-miR-34a has a role in the disease.

EXAMPLE 2: CELLULAR PATHWAYS AFFECTED BY HSA-MIR-34A

[00264] The mis-regulation of gene expression by hsa-miR-34a (Table 1) affects many cellular pathways that represent potential therapeutic targets for the control of cancer and other diseases and disorders. The inventors determined the identity and nature of the cellular genetic pathways affected by the regulatory cascade induced by hsa-miR-34a expression. Cellular pathway analyses were performed using Ingenuity Pathways Analysis (Version 4.0, Ingenuity® Systems, Redwood City, CA). Alteration of a given pathway was determined by Fisher's Exact test (Fisher, 1922). The most significantly affected pathways following over- expression of hsa-miR-34a in A549 cells are shown in Table 2.

[00265] These data demonstrate that hsa-miR-34a directly or indirectly affects the expression of numerous cancer-, cellular proliferation-, cellular development-, cell signaling-, and cell cycle-related genes and thus primarily affects functional pathways related to cancer, cellular growth, development, and proliferation. Those cellular processes all have integral roles in the development and progression of various cancers. Manipulation of the expression levels of genes in the cellular pathways shown in Table 2 represents a potentially useful therapy for cancer and other diseases in which increased or reduced expression of hsa-miR- 34a has a role in the disease.

EXAMPLE 3: PREDICTED GENE TARGETS OF HSA-MIR-34A

[00266] Gene targets for binding of and regulation by hsa-miR-34a were predicted using the proprietary algorithm miRNATarget™ (Asuragen), which is an implementation of the method proposed by Krek et al. (2005). Predicted target genes are shown in Table 3.

[00267] The predicted gene targets that exhibited altered mRNA expression levels in human cancer cells, following transfection with pre-miR hsa-miR-34a, are shown in Table 4.

[00268] The predicted gene targets of hsa-miR-34a whose mRNA expression levels are affected by hsa-miR-34a represent particularly useful candidates for cancer therapy and therapy of other diseases through manipulation of their expression levels.

EXAMPLE 4: CANCER RELATED GENE EXPRESSION ALTERED BY HSA-MIR-34A

[00269] Cell proliferation and survival pathways are commonly altered in tumors (Hanahan and Weinberg, 2000). The inventors have shown that hsa-miR-34a directly or indirectly regulates the transcripts of proteins that are critical in the regulation of these pathways. A detailed list of hsa-miR-34a targets that are associated with various cancer types are shown in Table 5. Hsa-miR-34a targets of particular interest are genes and their products that function in the regulation of intracellular signal transduction, cell cycle, chromosomal maintenance, cell adhesion and migration, mRNA translation, DNA replication, transcription, apoptosis and the thioredoxin redox system. Many of these targets have inherent oncogenic or tumor suppressor activity and, when deregulated, contribute to the malignant phenotype in vitro and in vivo.

[00270] Hsa-miR-34a affects intracellular signaling at various layers and controls the expression of secretory growth factors, transmembrane growth factor receptors as well as cytoplasmic signaling molecules. Examples of secreted proteins regulated by hsa-miR-34a are amphiregulin (AREG), connective tissue growth factor (CTGF), tumor growth factor β-2 (TGFB2) and the inflammatory chemokine interleukin 8 (IL8). IL-8 is frequently upregulated in various cancers and correlates with tumor vascularization, metastasis and poor prognosis (Rosenkilde and Schwartz, 2004; Sparmann and Bar-Sagi, 2004). Amphiregulin functions as a ligand to epidermal growth factor receptor (EGFR) and activates EGFR dependent signaling (Hynes and Lane, 2005). Amphiregulin is frequently expressed in ovarian, gastric and pancreatic carcinoma as well as hepatocellular carcinoma tissues and cell lines (Kitadai et al, 1993; Ebert et al, 1994; D1 Antonio et al, 2002; Castillo et al, 2006). Amphiregulin acts as a mitogenic and anti-apoptotic growth factor in hepatocarcinoma cells and contributes to the transformed phenotype of liver cancer cells. Inhibition of amphiregulin function by small interfering RNA (siRNA) or neutralizing antibodies diminishes the amphiregulin-mediated autocrine loop and oncogenic properties of hepatocarcinoma cells (Castillo et al, 2006). Amphiregulin expression also progressively increases from benign to malignant stages of prostate cancer and is indicative for poor response to treatment with the FDA-approved drug Iressa (gefitinib) in patients with non-small cell lung cancer (NSCLC) (Bostwick et al, 2004; Ishikawa et al, 2005).

[00271] CTGF (also referred to as insulin-like growth factor binding protein 8; IGFBP8) was originally described as a mitogen produced by umbilical vein endothelial cells (Bradham et ah, 1991). CTGF functions as a modulator of growth factor activity and is overexpressed in various tumors (Hishikawa et al, 1999; Shimo et al, 2001; Lin et al, 2005; Yang et al, 2005). CTGF is induced by hypoxia and enhances angiogenesis as well as the growth of tumor xenografts (Shimo et al, 2001; Yang et al, 2005). However, a coherent role for CTGF in cancer remains elusive and may depend on the cellular context (Hishikawa et al, 1999; Lin et al, 2005). TGF-β2 is the corresponding ligand to TGF-β receptors (TGFBR), a class of receptors that may function as tumor suppressors. Among these is TGFBR-2 which is also regulated by hsa-miR-34a. TGFBR-2 forms a functional complex with TGFBR-I and is the primary receptor for TGF-β (Massague et al., 2000). Central role of TGF-β is inhibition of cellular growth of numerous cell types, such as epithelial, endothelial, hematopoietic neural and mesenchymal cells. Many mammary and colorectal carcinomas with microsatellite instability harbor inactivating mutations of TGFBR-2 and therefore escape the growth-inhibitory function of TGF-β (Markowitz et al., 1995; Lucke et al., 2001).

[00272] Other transmembrane growth factor receptors regulated by hsa-miR-34a include Met and the Ras association domain family protein 2 (RAS SF2). RAS SF2 is a tumor suppressor candidate that is frequently downregulated in lung tumor cell lines (Vos et al., 2003). RASSF2 interacts with K-Ras and promotes cell cycle arrest and apoptosis. Met acts as the receptor for hepatocyte growth factor (HGF) and was originally isolated as an oncogene from a chemically transformed human cell line (Cooper et al., 1984; Dean et al., 1985). Met activating mutations are found in sporadic papillary renal cancer, childhood hepatocellular carcinoma and gastric cancer (Danilkovitch-Miagkova and Zbar, 2002). These somatic mutations are associated with increased aggressiveness and extensive metastases in various carcinomas. In several other cancer types, autocrine and paracrine mechanisms lead to an activation of Met signaling. The most frequent mechanism of Met activation, however, is overexpression which occurs in colorectal cancer, hepatocellular carcinoma, gastrinomas as well as carcinomas of the stomach, pancreas, prostate, ovary and breast (Boccaccio and Comoglio, 2006). Met overexpression correlates with a metastatic tumor phenotype and poor prognosis (Birchmeier et al., 2003). Cytoplasmic signaling molecules regulated by hsa-miR- 34a include PIK3CD, neurofibromin 1 and 2 (NFl, NF2) and AKAP12. AKAP12, also referred to as gravin or SSeCKS (Src suppressed C kinase substrate), functions as a kinase scaffold protein that tethers the enzyme-substrate interaction (Nauert et al., 1997).

Expression of AKAP 12 interferes with oncogenic cell transformation induced by the Src or Jun oncoproteins in vitro and is lost or reduced in numerous cancers, such as leukemia and carcinomas of the rectum, lung and stomach (Lin and Gelman, 1997; Cohen et al, 2001; Xia et al, 2001; Wikman et al, 2002; Boultwood et al, 2004; Choi et al, 2004; Mori et al, 2006). An apparent anti-oncogenic activity of AKAP 12 in prostate and gastric cancers marks this protein as a putative tumor suppressor (Xia et al, 2001; Choi et al, 2004). PIK3CD encodes pl lOδ, the delta catalytic subunit of class IA phosphoinositide 3-kinases (PBK). Similar to the well characterized pl lOα isoform, pl lOδ activates the Akt signaling pathway in response to most upstream receptor tyrosine kinases (Vanhaesebroeck et al, 1997). PIK3CD is consistently expressed at high levels in blasts cells from patients with acute myeloid leukemia (AML); inhibition of PIK3CD activity specifically blocks AML cell proliferation (Sujobert et al, 2005; Billottet et al, 2006). NFl and NF2 are bona fide tumor suppressors which - when either of them is lost or mutated - are the cause of neurofibromatosis, one of the most commonly inherited tumor-predisposition syndromes (Rubin and Gutmann, 2005). Loss of NFl or NF2 function occurs also in other malignancies, such as astrocytomas, gliomas and leukemia for NFl and hepatocellular and thyroid carcinomas for NF2 (McClatchey and Giovannini, 2005; Rubin and Gutmann, 2005). The tumor suppressor function of NFl can be explained by the fact that NFl acts as a GTP ase activating protein (GAP) towards the inherently oncogenic RAS protein, inactivating RAS by catalyzing the RAS-associated GTP into GDP. In contrast, the tumor suppressor role for NF2 is less well defined. NF2, also known as merlin or schwannomin, associates with the cellular membrane as well as the cytoskeleton and regulates membrane organization. Overexpression or constitutive activation of NF2 can block cell proliferation and oncogenic transformation (Tikoo et al, 1994; Lutchman and Rouleau, 1995; Jin et al, 2006).

[00273] Another class of genes and their corresponding proteins that are regulated by hsa- miR-34a, functions in the progression of the cell cycle. Some of these proteins play pivotal roles in the transition through Gl and S phases, such as retinoblastoma- like 1 (RBLl), cyclins Dl, D3, A2 (CCNDl, CCND3, CCNA2), cyclin dependent kinase 4 (CDK4) and CDK inhibitor 2c (CDKN2C). Others are required for proper segregation of sister chromatids during mitosis to maintain chromosomal stability. These include aurora kinase B (AURKB, STK12), breast cancer 1 and 2 (BRCAl; BRCA2), budding uninhibited by benzimidazoles 1 (BUBl), polo-like kinase 1 (PLKl) and cell division cycle 23 (CDC23, anaphase promoting complex subunit 8). BRCAl, BRC A2 and aurora kinase B show deregulated expression in a

various solid tumors, e.g., carcinomas of the breast, ovary, thyroid gland, lung, prostate and colorectum (Wooster and Weber, 2003; Keen and Taylor, 2004; Turner et al, 2004; Smith et al, 2005; Chieffi et al, 2006; Ulisse et al, 2006). PLKl (also referred to as serine-threonine protein kinase 13; STPKl 3) is a protein kinase that regulates mitotic spindle function to maintain chromosomal stability (Strebhardt and Ullrich, 2006). PLKl expression is tightly regulated during the cell cycle and peaks in M phase. PLKl is inherently oncogenic and directly inhibits the tumor suppressor function of p53 (Ando et al, 2004). Overexpression of PLKl induces a polynucleated phenotype and cellular transformation of NIH3T3 cells (Mundt et al, 1997; Smith et al, 1997). Likewise, PLKl shows increased expression levels in most solid tumors, including carcinomas of the breast, colon, lung, stomach and prostate (Table 5). PLKl overexpression is associated with disease progression and - when depleted - induces apoptosis in cancer cells (Liu and Erikson, 2003; Strebhardt and Ullrich, 2006). Currently, PLKl is being tested as a target of various small molecule inhibitors for future therapeutic intervention (Strebhardt and Ullrich, 2006).

[00274] RBLl, also known as pi 07, is a member of the retinoblastoma tumor suppressor protein family that includes the pocket proteins plO7, pl30 and pRb. Similar to the pRb prototype, RBLl interacts with the E2F family of transcription factors and blocks cell cycle progression and DNA replication (Sherr and McCormick, 2002). Accordingly, a subset of cancers show deregulated expression of RBLl (Takimoto et al, 1998; Claudio et al, 2002; Wu et al, 2002; Ito et al, 2003). Cyclins are co-factors of cyclin-dependent kinases (CDKs) (Malumbres and Barbacid, 2001). The expression of cyclins is tightly controlled during the cell cycle to govern the activity of individual CDKs. Cyclin A2 associates with CDK2 during S phase; cyclin Dl is the predominant co-factor of CDK4/6 in Gl phase. Since many cyclins are promoters of cell growth, cyclins - such as cyclin Dl - are frequently expressed at high levels in various tumor types (Donnellan and Chetty, 1998). CDK4 forms active complexes with D-type cyclins, including Dl, D2 and D3. Primary function of CDK4 is to inactivate members of the retinoblastoma protein family. CDK4 is overexpressed in numerous cancers and is currently being explored as a potential cancer drug target (Malumbres and Barbacid, 2001).

[00275] Transcription factors regulated by hsa-miR-34a include the winged/helix forkhead protein FoxMl, histone deacetylase 1 (HDACl), Jun and the zinc finger protein LIM domain only 4 (LMO4). LMO-4 is inherently oncogenic and inactivates the BRCA-I tumor

suppressor protein (Sum et al, 2002; Sum et al, 2005). LMO-4 is frequently overexpressed in multiple cancer types and predicts poor outcome in breast cancer (Visvader et al, 2001; Mizunuma et al, 2003; Sum et al, 2005; Taniwaki et al, 2006). Accordingly, RNAi directed against LMO-4 leads to reduced breast cancer cell growth and migration (Sum et al, 2005). Similar to LMO4, FoxMl also controls the expression of cell cycle genes, such as cyclins B and D (Wang et al, 2001). FoxMl is expressed at high levels in human glioblastomas and shows tumorigenic activity in various model systems (Kalin et al, 2006; Kim et al, 2006; Liu et al, 2006). Mice deficient in FoxMl fail to develop chemically induced hepatocellular carcinomas (Kalinichenko et al, 2004). Jun belongs to the basic region/leucine zipper (bZIP) class of transcription factors and is the cellular homolog of the avian oncoprotein v-Jun that induces tumor formation in birds (Maki et al, 1987). HDACl acts as a general inhibitor of transcription and cooperates with the retinoblastoma tumor suppressor protein (Rb) to decrease cell growth and proliferation (Wade, 2001).

[00276] Hsa-miR-34a also governs the expression of Fas and MCLl, both of which are functionally linked to the apoptotic pathway. MCLl is a member of the anti-apoptotic BCL- 2 (B cell lymphoma 2) gene family that give rise to two alternatively spliced gene products with opposing functions (Bae et al, 2000). High levels of MCLl are correlated with poor prognosis of patients with ovarian carcinoma and is indicative for leukemic relapse (Kaufmann et al, 1998; Shigemasa et al, 2002). RNA interference against MCLl induces a therapeutic response in gastric and hepatocellular carcinoma cells (Schulze-Bergkamen et al. , 2006; Zangemeister-Wittke and Huwiler, 2006). Fas, also known as CD95 or APO-I, is a transmembrane cell surface receptor that functions in the transduction of apoptotic signals in response to its ligand FasL (Houston and O'Connell, 2004). Reduced Fas expression is a common mechanism of cells to decrease the sensitivity to FasL-mediated cell death. Similarly, many different cancer types show lost or decreased Fas expression levels (Table 5). In colorectal carcinoma, Fas expression is progressively reduced in the transformation of normal epithelium to benign neoplasm, adenocarcinomas and metastases (Moller et al, 1994). Thus, despite expression of FasL, tumor cells may escape the FasL induced apoptotic signal. Transient transfection of hsa-miR-34a results in an increase of Fas transcripts and therefore may restore sensitivity to FasL in cancer cells.

[00277] Further growth-related genes regulated by hsa-miR-34a include thioredoxin (TXN), a 12-kDa thiol reductase targeting various proteins and multiple pathways.

Thioredoxin modulates the activity of transcription factors, induces the expression of angiogenic Hif-lα (hypoxia induced factor lα) as well as VEGF (vascular endothelial growth factor) and can act as a proliferative and anti-apoptotic agent (Marks, 2006). In accord, carcinomas of the lung, pancreas, cervix and liver show increased levels of thioredoxin. Thioredoxin expression is also correlated with aggressive tumor growth, poor prognosis and chemoresistance (Marks, 2006).

[00278] In summary, hsa-miR-34a governs the activity of proteins that are critical regulators of cell proliferation and survival. These targets are frequently deregulated in human cancer. Based on this review of the genes and related pathways that are regulated by miR-34a, introduction of hsa-miR-34a or an anti-hsa-miR-34a into a variety of cancer cell types would likely result in a therapeutic response.

EXAMPLE 5:

SYNTHETIC HSA-MIR-34A INHIBITS PROLIFERATION OF HUMAN LUNG CANCER CELLS

[00279] The inventors have previously demonstrated that hsa-miR-34 is involved in the regulation of numerous cell activities that represent intervention points for cancer therapy and for therapy of other diseases and disorders (U.S. Patent Applications serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed November 14, 2005, each of which is incorporated by reference). For example, overexpression of hsa-miR-34 decreases the proliferation and/or viability of certain normal or cancerous cell lines.

[00280] The development of effective therapeutic regimens requires evidence that demonstrates efficacy and utility of the therapeutic in various cancer models and multiple cancer cell lines that represent the same disease. The inventors assessed the therapeutic effect of hsa-miR-34a for lung cancer by using eight individual lung cancer cell lines. To measure cellular proliferation of lung cancer cells, the following non-small cell lung cancer (NSCLC) cells were used: cells derived from lung adenocarcinoma (A549, H522, Calu-3, HCC2935), cells derived from lung squamous cell carcinoma (H226), cell derived from lung adenosquamous cell carcinoma (H596), cells derived from lung bronchioalveolar carcinoma (H1650), and cells derived from lung large cell carcinoma (H460). Synthetic hsa-miR-34a (Pre-miR™-hsa-miR-34a, Ambion cat. no. AM17100) or negative control (NC) miRNA (Pre- miR™ microRNA Precursor Molecule-Negative Control #2; Ambion cat. no. AM17111) was

delivered via lipid-based transfection into A549, H522, H596, Calu-3, HCC2935, H1650, H460 cells and via electroporation into H226 cells.

[00281] Lipid-based reverse transfections were carried out in triplicate according to a published protocol (Ovcharenko et al., 2005) and the following parameters: cells (5,000- 12,000 per 96 well), 0.1-0.2 μl Lipofectamine™ 2000 (cat. no. 11668-019, Invitrogen Corp., Carlsbad, CA, USA) in 20 μl OptiMEM (Invitrogen), 30 nM final concentration of miRNA in 100 μl. Electroporation of H226 cells was carried out using the BioRad Gene Pulser Xcell™ instrument (BioRad Laboratories Inc., Hercules, CA, USA) with the following settings: 5 x 106 cells with 5 μg miRNA in 200 μl OptiMEM (1.6 μM miRNA), square wave pulse at 250 V for 5 ms. Electroporated H226 cells were seeded at 7,000 cells per 96-well in a total volume of 100 μl. All cells except for Calu-3 cells were harvested 72 hours post transfection or electroporation for assessment of cellular proliferation. Calu-3 cells were harvested 10 days post transfection. Proliferation assays were performed using Alamar Blue (Invitrogen) following the manufacturer's instructions. As a control for inhibition of cellular proliferation, siRNA against the motor protein kinesin 11, also known as Eg5, was used. Eg5 is essential for cellular survival of most eukaryotic cells and a lack thereof leads to reduced cell proliferation and cell death (Weil et al., 2002). siEg5 was used in lipid-based transfection following the same experimental parameters that apply to miRNA. The inventors also used a DNA topoisomerase II inhibitor, etoposide, at a final concentration of 10 μM and 50 μM as an internal standard for the potency of miRNAs. Etoposide is an FDA-approved DNA topoisomerase II inhibitor in the treatment of lung cancer. IC50 values for various lung cancer cells have been reported to range between <l-25 μM for SCLC and NSCLC cells (Tsai et al., 1993; Ohsaki et al., 1992). Percent (%) proliferation values from the Alamar Blue assay were normalized to values from cells treated with negative control miRNA. Percent proliferation of hsa-miR-34a treated cells relative to cells treated with negative control miRNA (100%) is shown in Table 7 and in FIG. 1.

Table 7. Percent (%) proliferation of lung cancer cell lines treated with hsa-miR-34a, Eg5- specifϊc siRNA (siEg5), etoposide, or negative control miRNA (NC). Values are normalized to values obtained from cells transfected with negative control miRNA (100% proliferation). NC, negative control miRNA; siEg5, Eg5-specific siRNA; SD, standard deviation; n.d., not determined.

[00282] Delivery of hsa-miR-34a inhibits cellular proliferation of lung cancer cells A549, H522, H596, Calu-3, HCC2935, H1650, H460, and H226 (Table 7 and FIG. 1). On average, hsa-miR-34a inhibits cellular proliferation by 25.30% (Table 7 and FIG. 1). hsa-miR-34a has maximal inhibitory activity in Calu-3 cells, reducing proliferation by 71.49%. The growth- inhibitory activity of hsa-miR-34a is comparable to that of etoposide at concentrations >10 μM. Since hsa-miR-34a induces a therapeutic response in all lung cancer cells tested, hsa- miR-34a may provide therapeutic benefit to a broad range of patients with lung cancer and other malignancies.

[00283] To evaluate the therapeutic activity of hsa-miR-34a over an extended period of time, the inventors conducted growth curve experiments in the presence of miRNA for up to 31 days in H226 lung cancer cells. Since in vitro transfections of naked interfering RNAs, such as synthetic miRNA, are transient by nature and compromised by the dilution of the oligo during ongoing cell divisions, miRNA was administered at multiple time points (Bartlett et al., 2006; Bartlett et al., 2007). To accommodate miRNA delivery into a large quantity of cells, hsa-miR-34a or negative control miRNA were delivered by the electroporation method. Briefly, 1 x 106 H226 were electroporated in triplicate with 1.6 μM hsa-miR-34a or negative control using the BioRad Gene Pulser Xcell™ instrument (BioRad Laboratories Inc., Hercules, CA, USA), seeded and propagated in regular growth medium. When the control cells reached confluence (days 6, 17 and 25), cells were harvested, counted and electroporated again with the respective miRNAs. To ensure similar treatment of both conditions as well as to accommodate exponential growth, the cell numbers used for the

second and third electroporation were titrated down to the lowest count. The population doubling was calculated from these electroporation events using the formula PD=ln(Nf/N0)/ln2 and adjusting for the fact that approximately 72% of newly seeded cells adhere to the plate. Cell counts were extrapolated and plotted on a linear scale (FIG. 2). Arrows represent electroporation days. Standard deviations are included in the graphs.

[00284] Repeated administration of hsa-miR-34a robustly inhibited proliferation of human lung cancer cells (FIG. 2). In contrast, cells treated with negative control miRNA showed normal exponential growth. hsa-miR-34a treatment resulted in 94.9% inhibition of H226 cell growth on day 31 (5.1% remaining cells) relative to the proliferation of control cells (100%).

[00285] The data indicate that hsa-miR-34a provides a useful therapeutic tool in the treatment of human lung cancer cells.

EXAMPLE 6:

HSA-MIR-34A, IN COMBINATION WITH SPECIFIC HUMAN MICRO-RNAS,

SYNERGISTICALLY INHIBITS PROLIFERATION OF

HUMAN LUNG CANCER CELL LINES

[00286] miRNAs function in multiple pathways controlling multiple cellular processes. Cancer cells frequently show aberrations in several different pathways, which determine their oncogenic properties. Therefore, administration of multiple miRNAs to cancer patients may result in a superior therapeutic benefit over administration of a single miRNA. The inventors assessed the efficacy of pair-wise miRNA combinations, administering hsa-miR-34a concurrently with either hsa-miR-124a, hsa-miR-126, hsa-miR-147, hsa-let-7b, hsa-let-7c or hsa-let-7g (Pre-miR™ miRNA, Ambion cat. no. AM17100). H460 lung cancer cells were transiently reverse-transfected in triplicate with each miRNA at a final concentration of 300 pM, resulting in 600 pM of total oligonucleotide. For negative controls, 600 pM of Pre- miR™ microRNA Precursor Molecule-Negative Control #2 (Ambion cat. no. AM17111) were used. To correlate the effect of various combinations with the effect of the sole miRNA, each miRNA at 300 pM was also combined with 300 pM negative control miRNA. Reverse transfection was carried out using the following parameters: 7,000 cells per 96 well, 0.15 μl Lipofectamine™ 2000 (Invitrogen) in 20 μl OptiMEM (Invitrogen), 100 μl total transfection volume. As an internal control for the potency of miRNA, etoposide was added at 10 μM and 50 μM to mock-transfected cells, 24 hours after transfection for the following 48 hours. Cells were harvested 72 hours after transfection and subjected to Alamar Blue

assays (Invitrogen). Percent proliferation values from the Alamar Blue assays were normalized to those obtained from cells treated with 600 pM negative control miRNA. Data are expressed as % proliferation relative to negative control miRNA-treated cells (Table 8, FIG. 3).

[00287] Transfection of 300 pM hsa-miR-34a in combination with 300 pM negative control miRNA reduces proliferation of H460 cells by 0.42% (99.58% proliferation relative to cells treated with 600 pM negative control miRNA; Table 8 and FIG. 3). Additive activity of pair- wise combinations (e.g., hsa-miR-34a plus hsa-miR-147) is defined as an activity that is greater than the sole activity of each miRNA (e.g., the activity of hsa-miR-34a plus hsa- miR-147 is greater than that observed for hsa-miR-34a plus NC and the activity of hsa-miR- 34a plus hsa-miR-147 is greater than that observed for hsa-miR-147 plus NC). Synergistic activity of pair- wise combinations is defined as an activity that is greater than the sum of the sole activity of each miRNA (e.g., the activity of hsa-miR-34a plus hsa-let-7g is greater than that observed for the sum of the activity of hsa-miR-34a plus NC and the activity of hsa-let- 7g plus NC). The data indicate that hsa-miR-34a combined with hsa-miR-124a, hsa-miR- 126, hsa-miR-147, hsa-let-7b, hsa-let-7c, or hsa-let-7g results in additive or synergistic activity (Table 8 and FIG. 3). Therefore, administering combinations of hsa-miR-34a with other miRNAs to cancer patients may induce a superior therapeutic response in the treatment of lung cancer. The combinatorial use of miRNAs represents a potentially useful therapy for cancer and other diseases.

Table 8. Cellular proliferation of H460 lung cancer cells in the presence of pair- wise miR- 34a miRNA combinations. Values are normalized to values obtained from cells transfected with 600 pM negative control (NC) miRNA. SD, standard deviation; S, synergistic effect; A, additive effect.

EXAMPLE 7:

SYNTHETIC HSA-MIR-34A INHIBITS TUMOR GROWTH OF HUMAN LUNG

CANCER XENOGRAFTS IN MICE

[00288] The inventors assessed the growth-inhibitory activity of hsa-miR-34a in human lung cancer xenografts grown in immunodeficient mice. Each 3 x 106 human H460 non- small cell lung cancer cells were mixed with BD Matrigel™, (BD Biosciences; San Jose, CA, USA; cat. no. 356237) in a 1 :1 ratio and subcutaneously injected into the lower back of 23 NOD/SCID mice (Charles River Laboratories, Inc.; Wilmington, MA, USA). Once animals developed palpable tumors (day 11 post xenograft implantation), a group of six animals received intratumoral injections of each 6.25 μg hsa-miR-34a (Dharmacon, Lafayette, CO) formulated with the lipid-based siPORT™ amine delivery agent (Ambion, Austin, TX; cat. no. AM4502) on days 11, 14, and 17. A control group of six animals received intratumoral injections of each 6.25 μg negative control miRNA (NC; Dharmacon, Lafayette, CO), following the same injection schedule that was used for hsa-miR-34a. Given an average mouse weight of 20 g, this dose equals 0.3125 mg/kg. In addition, a group of six H460 tumor-bearing mice received intratumoral injections of the siPORT™ amine delivery formulation lacking any oligonucleotide, and a group of five animals received intratumoral injections of phosphate -buffered saline (PBS). Caliper measurements were taken every 1-2 days, and tumor volumes were calculated using the formula, Volume = length x width x width / 2, in which the length is greater than the width. Average tumor volumes, standard deviations and p-values were calculated and plotted over time (FIG. 4).

[00289] As shown in FIG. 4, three doses of hsa-miR-34a robustly inhibited growth of established H460 lung tumors (white squares). On day 19, the average volume of tumors treated with hsa-miR-34a was 196 mm3. In contrast, tumors treated with negative control miRNA (black diamonds) grew at a steady pace and yielded tumors with an average size of 421 mm3 on day 19. Negative control tumors developed as quickly as tumors treated with either PBS or the siPORT amine only control, indicating that the therapeutic activity of hsa- miR-34a is specific.

[00290] The data indicate that hsa-miR-34a represents a particularly useful candidate in the treatment of patients with lung cancer. The therapeutic activity of hsa-miR-34a is highlighted by the fact that hsa-miR-34a inhibits tumor growth of tumors that had developed prior to treatment.

[00291] In addition, the data demonstrate the therapeutic utility of hsa-miR-34a in a lipid- based formulation.

EXAMPLE 8:

SYNTHETIC HSA-MIR-34A INHIBITS PROLIFERATION OF HUMAN PROSTATE CANCER CELLS

[00292] The inventors assessed the therapeutic effect of hsa-miR-34a for prostate cancer by using four individual human prostate cancer cell lines. To measure cellular proliferation of prostate cancer cells, the following prostate cancer cell lines were used: PPC-I, derived from a bone metastasis; Dul45, derived from a brain metastasis; RWPE2, derived from prostate cells immortalized by human papillomavirus 18 and transformed by the K-RAS oncogene; and LNCaP, derived from a lymph node metastasis (Bello et al, 1997; Pretlow et al, 1993; Stone et al, 1978; Brothman et al, 1991; Horoszewicz et al, 1980). PPC-I and Dul45 cells lack expression of the prostate-specific antigen (PSA) and are independent of androgen receptor (AR) signaling. In contrast, RWPE2 and LNCaP cells test positive for PSA and AR. Cells were transfected with synthetic hsa-miR-34a (Pre-miR™-hsa-miR-34a, Ambion cat. no. AM17100) or negative control miRNA (NC; Pre-miR™ microRNA Precursor Molecule-Negative Control #2; Ambion cat. no. AM17111) in a 96-well format using a lipid-based transfection reagent. Lipid-based reverse transfections were carried out in triplicate according to a published protocol (Ovcharenko et al, 2005) and the following parameters: cells (6,000-7,000 per 96 well), 0.1-0.2 μl Lipofectamine™ 2000 (cat. no. 11668-019, Invitrogen Corp., Carlsbad, CA, USA) in 20 μl OptiMEM (Invitrogen), 30 nM final concentration of miRNA in 100 μl. Proliferation was assessed 4-7 days post- transfection using Alamar Blue™ (Invitrogen) following the manufacturer's instructions. As a control for inhibition of cellular proliferation, siRNA against the motor protein kinesin 11 , also known as Eg5, was used. Eg5 is essential for cellular survival of most eukaryotic cells and a lack thereof leads to reduced cell proliferation and cell death (Weil et al, 2002). siEg5 was used in lipid-based transfection following the same experimental parameters that apply to miRNA. Fluorescent light units (FLU) were measured after 3 hours, normalized to the

control, and plotted as percent change in proliferation. Percent proliferation of hsa-miR-34a treated cells relative to cells treated with negative control miRNA (100%) is shown in Table 9 and in FIG. 5.

Table 9. Percent (%) proliferation of human prostate cancer cell lines treated with hsa-miR- 34a, Eg5-specifϊc siRNA (siEg5), or negative control miRNA (NC). Values are normalized to values obtained from cells transfected with negative control miRNA (100% proliferation). NC, negative control miRNA; siEg5, Eg5-specific siRNA; SD, standard deviation.

[00293] Delivery of hsa-miR-34a inhibits cellular proliferation of human prostate cancer cells PPC-I, Dul45, LNCaP and RWPE2 (Table 9 and FIG. 5). On average, hsa-miR-34a inhibits cellular proliferation by 37.18%. The growth-inhibitory activity of hsa-miR-34a is comparable to that of Eg5-directed siRNA. Since hsa-miR-34a induces a therapeutic response in all prostate cancer cells tested, hsa-miR-34a may provide therapeutic benefit to a broad range of patients with prostate cancer and other malignancies.

[00294] To evaluate the therapeutic activity of hsa-miR-34a over an extended period of time, we conducted growth curve experiments in the presence of miRNA for up to 22 days. Since in vitro transfections of naked interfering RNAs, such as synthetic miRNA, are transient by nature and compromised by the dilution of the oligo during ongoing cell divisions, miRNA was administered at multiple time points (Bartlett et al. 2006; Bartlett et al. 2007). To accommodate miRNA delivery into a large quantity of cells, the inventors employed the electroporation method to deliver hsa-miR-34a or negative control miRNA into PPC-I, PC3, and Dul45 human prostate cancer cells. Briefly, 1 x 106 PPC-I or PC3 cells, or 0.5 x 106 Dul45 cells were electroporated with 1.6 μM hsa-miR-34a or negative control using the BioRad Gene Pulser Xcell™ instrument (BioRad Laboratories Inc., Hercules, CA, USA), seeded and propagated in regular growth medium. Experiments with PC3 and Dul45 cells were carried out in triplicates. When the control cells reached confluence (days 4 and 11 for PPC-I; days 7 and 14 for PC3 and DuI 45), cells were harvested, counted and electroporated again with the respective miRNAs. To ensure similar treatment of both conditions as well as to accommodate exponential growth, the cell numbers used for the

second and third electroporation were titrated down to the lowest count. The population doubling was calculated from these electroporation events using the formula PD=ln(Nf/N0)/ln2 and adjusting for the fact that approximately 72% of newly seeded cells adhere to the plate. Cell counts were extrapolated and plotted on a linear scale (FIG. 6). Arrows represent electroporation days. Standard deviations are included in the graphs.

[00295] Repeated administration of hsa-miR-34a robustly inhibited proliferation of human prostate cancer cells (FIG. 6, white squares). In contrast, cells treated with negative control miRNA showed normal exponential growth (FIG. 6, black diamonds). hsa-miR-34a treatment resulted in 97.2% inhibition of PC3 cell growth on day 21 (2.8% cells relative to cells electroporated with negative control miRNA), and 93.1% inhibition of Dul45 cell growth on day 19 (6.9% cells relative to cells electroporated with negative control miRNA) relative to the proliferation of control cells (100%). All PPC-I cells electroporated with hsa- miR34a were eliminated by day 22.

[00296] The data indicate that hsa-miR-34a provides a useful therapeutic tool in the treatment of human prostate cancer cells.

EXAMPLE 9:

SYNTHETIC HSA-MIR-34A INHIBITS TUMOR GROWTH OF HUMAN PROSTATE CANCER XENOGRAFTS IN MICE

[00297] The in vitro studies demonstrate the therapeutic activity of hsa-miR-34a in cultured human prostate cancer cells. Therefore, hsa-miR-34a is likely to interfere with prostate tumor growth in the animal. To explore this possibility, the therapeutic potential of synthetic hsa-miR-34a miRNA was evaluated in the animal using the PPC-I human prostate cancer xenograft. 5 x 106 PPC-I cells per animal were electroporated with 1.6 μM synthetic hsa-miR-34a or negative control miRNA (Pre-miR™-hsa-miR-34a, Ambion cat. no. AM17100; NC, Pre-miR™ microRNA Precursor Molecule-Negative Control #2, Ambion cat. no. AM17111), mixed with BD Matrigel™, (BD Biosciences; San Jose, CA, USA; cat. no. 356237) in a 1 :1 ratio and implanted subcutaneously into the lower back of NOD/SCID mice (Charles River Laboratories, Inc.; Wilmington, MA, USA). A group of 7 mice was injected with hsa-miR-34a treated PPC-I cells, and a group of 7 animals was injected with PPC-I cells treated with negative control miRNA. To maintain steady levels of miRNA, 6.25 μg of each hsa-miR-34a or negative control miRNA conjugated with the lipid-based siPORT™ amine delivery agent (Ambion, Austin, TX; cat. no. AM4502) were repeatedly

administered on days 7, 13, 20, and 25 via intra-tumoral injections. Given an average mouse weight of 20 g, this dose equals 0.3125 mg/kg. Tumor growth was monitored by taking caliper measurements every 1-2 days for 32 days. Tumor volumes were calculated using the formula, Volume = length x width x width / 2, in which the length is greater than the width, and plotted over time (FIG. 7). Standard deviations are shown in the graph. All data points had p values < 0.01. p values were as low as 1.86 x 10"9 for data obtained on day 22, indicating statistical significance.

[00298] Repeated dosing with hsa-miR-34a blocked tumor growth of the human PPC-I prostate cancer xenograft (FIG. 7, white squares). The average volume of tumors that received hsa-miR-34a was 151 mm on day 32. Volumes of newly implanted tumors ranged between 111 and 155 mm (days 4-7) and thus, PPC-I tumors failed to develop in response to hsa-miR-34a treatment. In contrast, tumors locally treated with negative control miRNA were unaffected and continued to grow at a steady pace (FIG. 7, black diamonds). The average volume of tumors treated with negative control miRNA was 437 mm on day 32. Of note, each single administration with hsa-miR-34a resulted in an acute regression of tumor volumes. This effect was not induced with negative control miRNA, indicating that the antitumor activity of hsa-miR-34a is specific.

[00299] A histological analysis revealed that PPC-I tumors treated with negative control miRNA were densely packed with healthy, viable prostate cancer cells (FIG. 8). In contrast, hsa-miR-34a-treated tumors consisted mostly of matrigel with cellular debris and sparsely distributed cells, as well as occasional pockets with seemingly viable cells (FIG. 8, arrow). To gain further insight into the biological status of these cells, immunohistochemistry analyses specific for the proliferation marker Ki-67, as well as caspase 3, an indicator of apoptosis were performed. As illustrated in FIG. 9, areas with viable cells in hsa-miR-34a- treated tumors showed reduced levels of Ki-67 and increased levels of caspase 3. The data indicate that hsa-miR-34a inhibits tumor growth by an anti-proliferative and pro-apoptotic mechanism.

[00300] The data indicate that hsa-miR-34a provides a powerful therapeutic tool in the treatment of patients with prostate cancer.

[00301] In addition, the data demonstrate the therapeutic utility of hsa-miR-34a in a lipid- based formulation.

REFERENCES

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

U.S. Patent 4,337,063

U.S. Patent 4,404,289

U.S. Patent 4,405,711

U.S. Patent 4,659,774 U.S. Patent 4,682,195

U.S. Patent 4,683,202

U.S. Patent 4,704,362

U.S. Patent 4,816,571

U.S. Patent 4,870,287 U.S. Patent 4,959,463

U.S. Patent 5,141,813

U.S. Patent 5,143,854

U.S. Patent 5,202,231

U.S. Patent 5,214,136 U.S. Patent 5,221,619

U.S. Patent 5,223,618

U.S. Patent 5,242,974

U.S. Patent 5,264,566

U.S. Patent 5,264,566 U.S. Patent 5,268,486

U.S. Patent 5,288,644

U.S. Patent 5,324,633

U.S. Patent 5,378,825

U.S. Patent 5,384,261 U.S. Patent 5,399,363

U.S. Patent 5,405,783

U.S. Patent 5,412,087

U.S. Patent 5,424,186

U.S. Patent 5,428,148

U.S. Patent 5,429,807

U.S. Patent 5,432,049

U.S. Patent 5,436,327 U.S. Patent 5,445,934

U.S. Patent 5,446,137

U.S. Patent 5,466,468

U.S. Patent 5,466,786

U.S. Patent 5,468,613 U.S. Patent 5,470,710

U.S. Patent 5,470,967

U.S. Patent 5,472,672

U.S. Patent 5,480,980

U.S. Patent 5,492,806 U.S. Patent 5,503,980

U.S. Patent 5,510,270

U.S. Patent 5,525,464

U.S. Patent 5,525,464

U.S. Patent 5,527,681 U.S. Patent 5,529,756

U.S. Patent 5,532,128

U.S. Patent 5,543,158

U.S. Patent 5,545,531

U.S. Patent 5,547,839 U.S. Patent 5,554,501

U.S. Patent 5,554,744

U.S. Patent 5,556,752

U.S. Patent 5,561,071

U.S. Patent 5,571,639 U.S. Patent 5,574,146

U.S. Patent 5,580,726

U.S. Patent 5,580,732

U.S. Patent 5,583,013

U.S. Patent 5,593,839

U.S. Patent 5,599,672

U.S. Patent 5,599,695

U.S. Patent 5,602,240

U.S. Patent 5,602,244 U.S. Patent 5,610,289

U.S. Patent 5,610;287

U.S. Patent 5,614,617

U.S. Patent 5,623,070

U.S. Patent 5,624,711 U.S. Patent 5,631,134

U.S. Patent 5,637,683

U.S. Patent 5,639,603

U.S. Patent 5,641,515

U.S. Patent 5,645,897 U.S. Patent 5,652,099

U.S. Patent 5,654,413

U.S. Patent 5,658,734

U.S. Patent 5,661,028

U.S. Patent 5,665,547 U.S. Patent 5,667,972

U.S. Patent 5,670,663

U.S. Patent 5,672,697

U.S. Patent 5,677,195

U.S. Patent 5,681,947 U.S. Patent 5,695,940

U.S. Patent 5,700,637

U.S. Patent 5,700,922

U.S. Patent 5,705,629

U.S. Patent 5,708,153 U.S. Patent 5,708,154

U.S. Patent 5,714,606

U.S. Patent 5,728,525

U.S. Patent 5,739,169

U.S. Patent 5,744,305

U.S. Patent 5,760,395

U.S. Patent 5,763,167

U.S. Patent 5,770,358

U.S. Patent 5,777,092 U.S. Patent 5,789,162

U.S. Patent 5,792,847

U.S. Patent 5,800,992

U.S. Patent 5,801,005

U.S. Patent 5,807,522 U.S. Patent 5,824,311

U.S. Patent 5,830,645

U.S. Patent 5,830,880

U.S. Patent 5,837,196

U.S. Patent 5,846,225 U.S. Patent 5,846,945

U.S. Patent 5,847,219

U.S. Patent 5,856,174

U.S. Patent 5,858,988

U.S. Patent 5,859,221 U.S. Patent 5,871,928

U.S. Patent 5,872,232

U.S. Patent 5,876,932

U.S. Patent 5,886,165

U.S. Patent 5,919,626 U.S. Patent 5,922,591

U.S. Patent 6,004,755

U.S. Patent 6,040,193

U.S. Patent 6,087,102

U.S. Patent 6,251,666 U.S. Patent 6,368,799

U.S. Patent 6,383,749

U.S. Patent 6,617,112

U.S. Patent 6,638,717

U.S. Patent 6,720,138

U.S. Patent 6,723,509 U.S. Appln. Serial 09/545,207 U.S. Appln. Serial 10/667,126 U.S. Appln. Serial 11/141,707 U.S. Appln. Serial 11/273,640 U.S. Appln. Serial 11/349,727 U.S. Prov. Appln. Serial 60/575,743 U.S. Prov. Appln. Serial 60/649,584 U.S. Prov. Appln. Serial 60/650,807

Akiba et al, Int. J. Oncol, 18(2):257-264, 2001.

Akino et al, Gastroenterology, 129(1):156-169, 2005.

Ando et al, J. Biol Chem., 279(24):25549-25561, 2004.

Arap et al, Cancer Res., 55(6): 1351-1354, 1995. Aspland et al, Oncogene, 20(40):5708-5717, 2001.

Austin-Ward and Villaseca, Revista Medica de Chile, 126(7):838-845, 1998.

Ausubel et al, In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994.

Bae et al, J. Biol. Chem., 275(33):25255-25261, 2000. Bagga et al, Cell, 122(4):553-563, 2005.

Bai et al, Histol Histopathol, 18(2):449-457, 2003.

Bar-Shira et al, Cancer Res., 62(23):6803-6807, 2002.

Bartlett et al, Biotechnol Bioeng, 97(4):909-21, 2007.

Bartlett et al, Nucleic Acids Res, 34(l):322-33, 2006. Barton et al, Clin. Cancer Res., 3(9):1579-1586, 1997.

Beisner et al, Cancer Res., 66(15):7554-7561, 2006.

Bello et al, Carcinogenesis, 18(6):1215-23, 1997.

Billottet et al, Oncogene, 25(50):6648-6659, 2006.

Birchmeier et al, Nat. Rev. MoI Cell Biol, 4(12):915-925, 2003. Biswas et al, Cancer Res., 64(14):4687-4692, 2004.

Boccaccio and Comoglio, Nat. Rev. Cancer, 6(8): 637-645, 2006.

Bodner-Adler et al, Anticancer Res., 21(1B):8O9-812, 2001.

Borczuk et al, Am. J. Pathol, 163(5): 1949-1960, 2003.

Bostwick et al, Prostate, 58(2): 164-168, 2004.

Boultwood et al, Br. J. Haematol, 126(4):508-511, 2004.

Boutros et al, Biochem. Biophys. Res. Commun., 325(4): 1115-1121, 2004.

Bradham ^ α/., J. Cell Biol, 114(6):1285-1294, 1991.

Bravou et al., Int. J. Oncol, 27(6): 1511-1518, 2005. Brothman et al, J. Urol, 145(5):1088-91, 1991.

Bui et al, Br. J. Cancer, 77(2):319-324, 1998.

Bukowski et al, Clinical Cancer Res., 4(10):2337-2347, 1998.

Cahill et al, Nature, 392(6673):300-303, 1998.

Caldas et al, Cancer Res., 54:3568-3573, 1994. Calin and Croce, Nat. Rev. Cancer, 6(11):857-866, 2006.

Carrington and Ambros, Science, 301(5631):336-338, 2003.

Castillo et al, Cancer Res., 66(12):6129-6138, 2006.

Cheng et al, Cancer Res., 54(21):5547-5551, 1994.

Chieffi et al, Prostate, 66(3):326-333, 2006. Choi et al, Oncogene, 23(42):7095-7103, 2004.

Cho-Vega et al, Hum. Pathol, 35(9):1095-l 100, 2004.

Christodoulides et al, Microbiology, 144(Pt l l):3027-3037, 1998.

Claudio et al, Clin. Cancer Res., 8(6): 1808-1815, 2002.

Cohen et al, Oncogene, 20(2): 141-146, 2001. Cooper et al, Nature, 311(5981):29-33, 1984.

Croci et al, Cancer Res., 64(5): 1730-1736, 2004.

Cummins et al, In: IRT: Nucleosides and nucleosides, La Jolla CA, 72, 1996.

Danilkovitch-Miagkova and Zbar, J. Clin. Invest., 109(7):863-867, 2002.

D Antonio et al, Int. J. Oncol, 21(5):941-948, 2002. Davidson et al, J. Immunother., 21(5):389-398, 1998.

ΌQΆΆ et al, Nature, 318(6044):385-388, 1985.

Denli et al, Trends Biochem. Sci., 28:196, 2003.

Oidenko, Biotechniques, 31(5): 1106-1116, 1118, 1120-1121, 2001.

Dillman, Cancer Biother. Radiopharm., 14(l):5-10, 1999. Donnellan and Chetty, MoI Pathol, 51(l):l-7, 1998.

Ebert et al, Cancer Res., 54(15):3959-3962, 1994.

Eferl et al, Cell, 112(2): 181-192, 2003.

Emptage et al, Neuron, 29(1): 197-208, 2001.

Endoh et al, Br. J. Cancer, 93(12): 1395-1399, 2005.

EP 266,032

EP 373 203

EP 785 280

EP 799 897 Esquela-Kerscher and Slack, Nat. Rev. Cancer, 6(4):259-269, 2006.

Filipits et al, Clin. Cancer Res., 8(3):729-733, 2002.

Fisher, J. Royal Statistical. Soc, 85(l):87-94, 1922.

Fleischer et al, Int. J. Oncol, 28(l):25-32, 2006.

Florenes et al, Clin. Cancer Res., 6(9):3614-3620, 2000. Fodor et al, Biochemistry, 30(33):8102-8108, 1991.

Froehler et al, Nucleic Acids Res., 14(13):5399-5407, 1986.

Ginestier et al, Clin. Cancer Res., 12(15):4533-4544, 2006.

Grabsch et al, J. Pathol, 200(1): 16-22, 2003.

Gratas et al, Cancer Res., 58(10):2057-2062, 1998. Griffey et al, J. Mass Spectrom., 32(3):305-13, 1997.

Halkidou et al, Prostate, 59(2):177-189, 2004.

Han et al, Oncogene, 23(7):1333-1341, 2004.

Hanahan and Weinberg, Cell, 100:57-70, 2000.

Hanibuchi et al, Int. J. Cancer, 78(4):480-485, 1998. Hartmann et al, Cancer Res., 59(7):1578-1583, 1999.

Hellstrand et al, Acta Oncologica, 37(4):347-353, 1998.

Hishikawa et al, J. Biol. Chem., 274(52):37461-37466, 1999.

Horoszewicz et al, Prog Clin Biol Res, 37(115-32, 1980.

Houston and O'Connell, Curr. Opin. Pharmacol, 4(4):321-326, 2004. Huguet et al, Cancer Res., 54(10):2615-2621, 1994.

Hui and Hashimoto, Infection Immun., 66(11):5329-5336, 1998.

Hussussian et α/., Λtø. Genet., 8(1):15-21, 1994.

Hynes and Lane, Nat. Rev. Cancer, 5(5):341-354, 2005.

Iolascon et al, Hepatology, 27(4):989-995, 1998. Ishikawa et al, Cancer Res., 65(20):9176-9184, 2005.

Itakura and Riggs, Science, 209:1401-1405, 1980.

Ito et al, Anticancer Res., 21(2A):1043-1048, 2001.

Ito et al, Anticancer Res., 23(5A):3819-3824, 2003.

Jin et al, Nature, 442(7102):576-579, 2006.

Jonson et al., Int. J. Oncol., 19(1):71-81, 2001.

Ju et al, Gene Ther., 7(19): 1672-1679, 2000.

Kalin et al, Cancer Res., 66(3):1712-1720, 2006.

Kalinichenko et al, Genes Dev., 18(7):830-850, 2004. Kamb et al, Science, 2674:436-440, 1994.

Kaufmann et al, Blood, 91(3):991-1000, 1998.

Kawai et al, Int. J. Cancer, 107(3):353-358, 2003.

Keen and Taylor, Nat. Rev. Cancer, 4(12):927-936, 2004.

Kim et al, Cancer Res., 66(4):2153-2161, 2006. Kitada et al, Blood, 91(9):3379-3389, 1998.

Kitadai et al, Jpn. J. Cancer Res., 84(8):879-884, 1993.

Klostermeier and Millar, Biopolymers, 61(3): 159-79, 2001-2002.

Koliopanos et al, World J. Surg., 26(4):420-427, 2002.

Romberg and Baker, DNA Replication, 2nd Ed., Freeman, San Francisco, 1992. Krajewska et al, Am. J. Pathol, 148(5): 1567-1576, 1996.

Krasagakis et al, Br. J. Cancer, 77(9): 1492-1494, 1998.

Krek et al, Nature Genet., 37:495-500, 2005.

Kulkarni et al, Leukemia, 16(1): 127-134, 2002.

Lagos-Quintana et al, Science, 294(5543):853-858, 2001. Lambros et al, J. Pathol, 205(l):29-40, 2005.

Lau et al, Science, 294(5543):858-862, 2001.

Lee and Ambros, Science, 294(5543):862-864, 2001.

Lim et al, Nature, 433(7027):769-773, 2005.

Lin and Gelman, Cancer Res., 57(l l):2304-2312, 1997. Lin et al, Gastroenterology, 128(l):9-23, 2005.

Liu and Erikson, Proc. Natl. Acad. Sci. USA, 100(10):5789-5794, 2003.

Liu and Matsuura, Cell Cycle, 4(l):63-66, 2005.

Liu et al, Cancer Res., 66(2):653-658, 2006.

Liu et al, Cancer Res., 66(7):3593-3602, 2006. Lopez-Beltran et α/., J. Pαtfzo/., 209(l):106-113, 2006.

Lucke et al, Cancer Res., 61(2):482-485, 2001.

Lutchman and Rouleau, Cancer Res., 55(l l):2270-2274, 1995.

Mahtouk et al, Oncogene, 24(21):3512-3524, 2005.

Maki et al, Proc. Natl. Acad. Sci. USA, 84(9):2848-2852, 1987.

Malumbres and Barbacid, Nat. Rev. Cancer, 1(3):222-231, 2001.

Markowitz et al, Science, 268(5215): 1336-1338, 1995.

Markowitz, Biochim. Biophys. Acta, 1470(l):M13-20, 2000.

Marks, Semin. Cancer Biol, 16(6):436-443, 2006. Marsters et al, Recent Prog. Horm. Res., 54:225-234, 1999.

Martinez-Lorenzo et al, Int. J. Cancer, 75(3):473-481, 1998.

Massague et al, Cell, 103(2):295-309, 2000.

Matsumoto et al, Leukemia, 14(10):1757-1765, 2000.

McClatchey and Giovannini, Genes Dev., 19(19):2265-2277, 2005. Meng et al, Gastroenterology, 130:2113-2129, 2006.

Miyake et al, Cancer, 86(2):316-324, 1999.

Mizunuma et al, Br. J. Cancer, 88(10):1543-1548, 2003.

Moller et al, Int. J. Cancer, 57(3):371-377, 1994.

Montero et al, Clin. Cancer Res., 4(9):2161-2168, 1998. Mori et al, Cancer Res., 54(13):3396-3397, 1994.

Mori et al, Gastroenterology, 131(3):797-808, 2006.

Morishita et al, Hepatology, 40(3):677-686, 2004.

Mundt et al, Biochem. Biophys. Res. Commun., 239(2):377-385, 1997.

Nakagawa et al, Oncogene, 23(44):7366-7377, 2004. Nauert et al, Curr. Biol, 7(l):52-62, 1997.

Nobri et al, Nature (London), 368:753-756, 1995.

Nupponen et al, Am. J. Pathol, 154(6):1777-1783, 1999.

Nupponen et al, Genes Chromosomes Cancer, 28(2):203-210, 2000.

Ohsaki et al, Cancer Res, 52(13):3534-8, 1992. Okamoto et al, Hepatology, 38(5): 1242-1249, 2003.

Okamoto et al, Proc. Natl. Acad. Sci. USA, 91(23): 11045-11049, 1994.

Olsen et al, Dev. Biol, 216:671, 1999.

Orlow et al, Cancer Res, 54(11):2848-2851, 1994.

Ovcharenko et al, Rna, l l(6):985-93, 2005. Pan et al, Neurol. Res., 24(7):677-683, 2002.

PCT Appln. WO 0138580

PCT Appln. WO 0168255

PCT Appln. WO 03020898

PCT Appln. WO 03022421

PCT Appln. WO 03023058

PCT Appln. WO 03029485

PCT Appln. WO 03040410

PCT Appln. WO 03053586 PCT Appln. WO 03066906

PCT Appln. WO 03067217

PCT Appln. WO 03076928

PCT Appln. WO 03087297

PCT Appln. WO 03091426 PCT Appln. WO 03093810

PCT Appln. WO 03100012

PCT Appln. WO 03100448A1

PCT Appln. WO 04020085

PCT Appln. WO 04027093 PCT Appln. WO 09923256

PCT Appln. WO 09936760

PCT Appln. WO 93/17126

PCT Appln. WO 95/11995

PCT Appln. WO 95/21265 PCT Appln. WO 95/21944

PCT Appln. WO 95/35505

PCT Appln. WO 96/31622

PCT Appln. WO 97/10365

PCT Appln. WO 97/27317 PCT Appln. WO 9743450

PCT Appln. WO 99/35505

Pietras et al, Oncogene, 17(17):2235-2249, 1998.

Pretlow et al, J Natl Cancer Inst, 85(5):394-8, 1993.

Pruitt et al, Nucleic Acids Res., 33(l):D501-D504, 2005. Pruneri et al, Clin. Cancer Res., 1 l(l):242-248, 2005.

Qian et al, Proc. Natl. Acad. Sci. USA, 99(23): 14925-14930, 2002.

Qin et al, Proc. Natl. Acad. Sci. USA, 95(24):14411-14416, 1998.

Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580, 1990.

Rincon-Arano et al, Cancer, 97(3):575-585, 2003.

Rosenkilde and Schwartz, Apmis, 112(7-8):481-495, 2004.

Ru et al, Oncogene, 21(30):4673-4679, 2002.

Rubin and Gutmann, Nat. Rev. Cancer, 5(7):557-564, 2005.

Rust et al., J. Clin. Pathol, 58(5):520-524, 2005. Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3rd Ed., Cold Spring Harbor Laboratory Press, 1989.

Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3rd Ed., Cold Spring Harbor Laboratory Press, 2001.

Sambrook et al, In: DNA microaarays: a molecular cloning manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2003.

Sanchez-Aguilera et al, Blood, 103(6):2351-2357, 2004.

Sano et al, Histopathology, 46(5):532-539, 2005.

Scheit, In: Synthesis and Biological Function, Wiley-Interscience, New York, 171-172, 1980.

Schulze-Bergkamen et al, BMC Cancer, 6:232, 2006. Seggerson et al, Dev. Biol, 243:215, 2002.

Serrano et al, Nature, 366:704-707, 1993.

Serrano et al, Science, 267(5195):249-252, 1995.

Sherr and McCormick, Cancer Cell, 2(2): 103-112, 2002.

Shetty et al, Br. J. Cancer, 93(11): 1295-1300, 2005. Shigeishi et al, Oncol. Rep., 15(4):933-938, 2006.

Shigemasa et al, Jpn. J. Cancer Res, 93(5):542-550, 2002.

Shimo et al, Cancer Lett., 174(l):57-64, 2001.

Shimoyama et α/., Clin. Cancer Res., 5(5): 1125-1130, 1999.

Shinoura et al, Cancer Gene Ther., 7(2):224-232, 2000. Sieghart et al, J. Hepatol, 44(1): 151-157, 2006.

Smith et al, Biochem. Biophys. Res. Commun., 234(2):397-405, 1997.

Smith et al, Br. J. Cancer, 93(6):719-729, 2005.

Solic and Davies, Exp. Cell Res., 234(2):465-476, 1997.

Sparmann and Bar-Sagi, Cancer Cell, 6(5):447-458, 2004. Stone et al, Int J Cancer, 21(3):274-81, 1978.

Strebhardt and Ullrich, Nat. Rev. Cancer, 6(4):321-330, 2006.

Sujobert et al, Blood, 106(3): 1063-1066, 2005.

Sum et al, J. Biol. Chem., 277(10):7849-7856, 2002.

Sum et al, Proc. Natl. Acad. Sci. USA, 102(21):7659-7664, 2005.

Takimoto et al, Biochem. Biophys. Res. Commun., 251(l):264-268, 1998.

Tanami et al, Lab. Invest., 85(9): 1118-1129, 2005.

Taniwaki et al, Int. J. Oncol, 29(3):567-575, 2006.

Tanner et al, Clin. Cancer Res., 6(5):1833-1839, 2000. Thome, Nat. Rev. Immunol, 4(5):348-359, 2004.

Tikoo et al, J. Biol Chem., 269(38):23387-23390, 1994.

Troncone et al, J. Clin. Pathol, 60(4):377-381, 2007.

Tsai et al, J Natl Cancer Inst, 85(11):897-901, 1993.

Turner et al, Nat. Rev. Cancer, 4(10):814-819, 2004. UK Appln. 8 803 000

UK Patent 1,529,202

Ulisse et al, Int. J. Cancer, 119(2):275-282, 2006.

Vanhaesebroeck et al, Trends Biochem. Sci., 22(7):267-272, 1997.

Viard-Leveugle et al, J. Pathol, 201(2):268-277, 2003. Visvader et al, Proc. Natl. Acad. Sci. USA, 98(25): 14452-14457, 2001.

Vogt et al, Cell Cycle, 5(9):946-949, 2006.

Vos et al, J. Biol. Chem., 278(30):28045-28051, 2003.

Wade, Hum. MoI Genet., 10(7):693-698, 2001.

Wang et al, Proc. Natl. Acad. Sci. USA, 98(20): 11468-11473, 2001. Weil et al, Biotechniques, 33(6): 1244-8, 2002.

Weiss and Bohmann, Cell Cycle, 3(2): 111-113, 2004.

Wikman et al, Oncogene, 21(37):5804-5813, 2002.

Wohlschlegel et al, Am. J. Pathol, 161(l):267-273, 2002.

Wooster and Weber, N Engl. J. Med., 348(23):2339-2347, 2003. Wu et al, Eur. J. Cancer, 38(14):1838-1848, 2002.

Wu et al, Eur. J. Cancer, 42(4):557-565, 2006.

Wu et al, Int. J. Gynecol. Cancer, 16(4): 1668-1672, 2006.

Wuilleme-Toumi et al, Leukemia, 19(7): 1248-1252, 2005.

Xi et al, Clin. Cancer Res., 12(8):2484-2491, 2006a. Xi et al, Clin. Chem., 52(3):520-523, 2006b.

Xia et al, Cancer Res., 6\(\4):5644-565\, 2001.

Yamagata et al, Cancer Res., 65(1):157-165, 2005.

Yang et al, Cancer Cell, 9(6):445-457, 2006.

Yang et al, Cancer Res., 65(19):8887-8895, 2005.

Yu and Feig, Oncogene, 21(49):7557-7568, 2002.

Zangemeister-Wittke and Huwiler, Cancer Biol. Ther., 5(10): 1355-1356, 2006.

Zha et al, Cell, 94(6):703-714, 1998.

PATENTSCOPE®

Related Links

E-Newsletters